Human FUT3/CD174/ FT3B ORF/cDNA clone-Lentivirus particle (NM_000149)
Pre-made Human FUT3/CD174/ FT3B Lentiviral expression plasmid for FUT3 lentivirus packaging, FUT3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to FUT3/CD174 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003593 | Human FUT3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003593 |
Gene Name | FUT3 |
Accession Number | NM_000149 |
Gene ID | 2525 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1086 bp |
Gene Alias | CD174, FT3B, FucT-III, LE, Les |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATCCCCTGGGTGCAGCCAAGCCACAATGGCCATGGCGCCGCTGTCTGGCCGCACTGCTATTTCAGCTGCTGGTGGCTGTGTGTTTCTTCTCCTACCTGCGTGTGTCCCGAGACGATGCCACTGGATCCCCTAGGGCTCCCAGTGGGTCCTCCCGACAGGACACCACTCCCACCCGCCCCACCCTCCTGATCCTGCTATGGACATGGCCTTTCCACATCCCTGTGGCTCTGTCCCGCTGTTCAGAGATGGTGCCCGGCACAGCCGACTGCCACATCACTGCCGACCGCAAGGTGTACCCACAGGCAGACACGGTCATCGTGCACCACTGGGATATCATGTCCAACCCTAAGTCACGCCTCCCACCTTCCCCGAGGCCGCAGGGGCAGCGCTGGATCTGGTTCAACTTGGAGCCACCCCCTAACTGCCAGCACCTGGAAGCCCTGGACAGATACTTCAATCTCACCATGTCCTACCGCAGCGACTCCGACATCTTCACGCCCTACGGCTGGCTGGAGCCGTGGTCCGGCCAGCCTGCCCACCCACCGCTCAACCTCTCGGCCAAGACCGAGCTGGTGGCCTGGGCGGTGTCCAACTGGAAGCCGGACTCAGCCAGGGTGCGCTACTACCAGAGCCTGCAGGCTCATCTCAAGGTGGACGTGTACGGACGCTCCCACAAGCCCCTGCCCAAGGGGACCATGATGGAGACGCTGTCCCGGTACAAGTTCTACCTGGCCTTCGAGAACTCCTTGCACCCCGACTACATCACCGAGAAGCTGTGGAGGAACGCCCTGGAGGCCTGGGCCGTGCCCGTGGTGCTGGGCCCCAGCAGAAGCAACTACGAGAGGTTCCTGCCACCCGACGCCTTCATCCACGTGGACGACTTCCAGAGCCCCAAGGACCTGGCCCGGTACCTGCAGGAGCTGGACAAGGACCACGCCCGCTACCTGAGCTACTTTCGCTGGCGGGAGACGCTGCGGCCTCGCTCCTTCAGCTGGGCACTGGATTTCTGCAAGGCCTGCTGGAAACTGCAGCAGGAATCCAGGTACCAGACGGTGCGCAGCATAGCGGCTTGGTTCACCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0076-Ab | Anti-FUT3 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0076-Ag | FUT3 protein |
ORF Viral Vector | pGMLV000456 | Human FUT3 Lentivirus plasmid |
ORF Viral Vector | pGMLP003593 | Human FUT3 Lentivirus plasmid |
ORF Viral Vector | vGMLV000456 | Human FUT3 Lentivirus particle |
ORF Viral Vector | vGMLP003593 | Human FUT3 Lentivirus particle |
Target information
Target ID | GM-IP0076 |
Target Name | FUT3 |
Gene ID | 2525 |
Gene Symbol and Synonyms | CD174,FT3B,FucT-III,FUT3,LE,Les |
Uniprot Accession | P21217 |
Uniprot Entry Name | FUT3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Not Available |
Gene Ensembl | ENSG00000171124 |
Target Classification | Checkpoint-Immuno Oncology |
The Lewis histo-blood group system comprises a set of fucosylated glycosphingolipids that are synthesized by exocrine epithelial cells and circulate in body fluids. The glycosphingolipids function in embryogenesis, tissue differentiation, tumor metastasis, inflammation, and bacterial adhesion. They are secondarily absorbed to red blood cells giving rise to their Lewis phenotype. This gene is a member of the fucosyltransferase family, which catalyzes the addition of fucose to precursor polysaccharides in the last step of Lewis antigen biosynthesis. It encodes an enzyme with alpha(1,3)-fucosyltransferase and alpha(1,4)-fucosyltransferase activities. Mutations in this gene are responsible for the majority of Lewis antigen-negative phenotypes. Differences in the expression of this gene are associated with host susceptibility to viral infection. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.