Human FUT3/CD174/ FT3B ORF/cDNA clone-Lentivirus particle (NM_000149)

Pre-made Human FUT3/CD174/ FT3B Lentiviral expression plasmid for FUT3 lentivirus packaging, FUT3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FUT3/CD174 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003593 Human FUT3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003593
Gene Name FUT3
Accession Number NM_000149
Gene ID 2525
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1086 bp
Gene Alias CD174, FT3B, FucT-III, LE, Les
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATCCCCTGGGTGCAGCCAAGCCACAATGGCCATGGCGCCGCTGTCTGGCCGCACTGCTATTTCAGCTGCTGGTGGCTGTGTGTTTCTTCTCCTACCTGCGTGTGTCCCGAGACGATGCCACTGGATCCCCTAGGGCTCCCAGTGGGTCCTCCCGACAGGACACCACTCCCACCCGCCCCACCCTCCTGATCCTGCTATGGACATGGCCTTTCCACATCCCTGTGGCTCTGTCCCGCTGTTCAGAGATGGTGCCCGGCACAGCCGACTGCCACATCACTGCCGACCGCAAGGTGTACCCACAGGCAGACACGGTCATCGTGCACCACTGGGATATCATGTCCAACCCTAAGTCACGCCTCCCACCTTCCCCGAGGCCGCAGGGGCAGCGCTGGATCTGGTTCAACTTGGAGCCACCCCCTAACTGCCAGCACCTGGAAGCCCTGGACAGATACTTCAATCTCACCATGTCCTACCGCAGCGACTCCGACATCTTCACGCCCTACGGCTGGCTGGAGCCGTGGTCCGGCCAGCCTGCCCACCCACCGCTCAACCTCTCGGCCAAGACCGAGCTGGTGGCCTGGGCGGTGTCCAACTGGAAGCCGGACTCAGCCAGGGTGCGCTACTACCAGAGCCTGCAGGCTCATCTCAAGGTGGACGTGTACGGACGCTCCCACAAGCCCCTGCCCAAGGGGACCATGATGGAGACGCTGTCCCGGTACAAGTTCTACCTGGCCTTCGAGAACTCCTTGCACCCCGACTACATCACCGAGAAGCTGTGGAGGAACGCCCTGGAGGCCTGGGCCGTGCCCGTGGTGCTGGGCCCCAGCAGAAGCAACTACGAGAGGTTCCTGCCACCCGACGCCTTCATCCACGTGGACGACTTCCAGAGCCCCAAGGACCTGGCCCGGTACCTGCAGGAGCTGGACAAGGACCACGCCCGCTACCTGAGCTACTTTCGCTGGCGGGAGACGCTGCGGCCTCGCTCCTTCAGCTGGGCACTGGATTTCTGCAAGGCCTGCTGGAAACTGCAGCAGGAATCCAGGTACCAGACGGTGCGCAGCATAGCGGCTTGGTTCACCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0076-Ab Anti-FUT3 monoclonal antibody
    Target Antigen GM-Tg-g-IP0076-Ag FUT3 protein
    ORF Viral Vector pGMLV000456 Human FUT3 Lentivirus plasmid
    ORF Viral Vector pGMLP003593 Human FUT3 Lentivirus plasmid
    ORF Viral Vector vGMLV000456 Human FUT3 Lentivirus particle
    ORF Viral Vector vGMLP003593 Human FUT3 Lentivirus particle


    Target information

    Target ID GM-IP0076
    Target Name FUT3
    Gene ID 2525
    Gene Symbol and Synonyms CD174,FT3B,FucT-III,FUT3,LE,Les
    Uniprot Accession P21217
    Uniprot Entry Name FUT3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000171124
    Target Classification Checkpoint-Immuno Oncology

    The Lewis histo-blood group system comprises a set of fucosylated glycosphingolipids that are synthesized by exocrine epithelial cells and circulate in body fluids. The glycosphingolipids function in embryogenesis, tissue differentiation, tumor metastasis, inflammation, and bacterial adhesion. They are secondarily absorbed to red blood cells giving rise to their Lewis phenotype. This gene is a member of the fucosyltransferase family, which catalyzes the addition of fucose to precursor polysaccharides in the last step of Lewis antigen biosynthesis. It encodes an enzyme with alpha(1,3)-fucosyltransferase and alpha(1,4)-fucosyltransferase activities. Mutations in this gene are responsible for the majority of Lewis antigen-negative phenotypes. Differences in the expression of this gene are associated with host susceptibility to viral infection. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.