Human CCR8/CC-CKR-8/CCR-8 ORF/cDNA clone-Lentivirus particle (NM_005201)

Cat. No.: vGMLP003581

Pre-made Human CCR8/CC-CKR-8/CCR-8 Lentiviral expression plasmid for CCR8 lentivirus packaging, CCR8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCR8/CC-CKR-8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003581 Human CCR8 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003581
Gene Name CCR8
Accession Number NM_005201
Gene ID 1237
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1068 bp
Gene Alias CC-CKR-8,CCR-8,CDw198,CKRL1,CMKBR8,CMKBRL2,CY6,GPRCY6,TER1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATTATACACTTGACCTCAGTGTGACAACAGTGACCGACTACTACTACCCTGATATCTTCTCAAGCCCCTGTGATGCGGAACTTATTCAGACAAATGGCAAGTTGCTCCTTGCTGTCTTTTATTGCCTCCTGTTTGTATTCAGTCTTCTGGGAAACAGCCTGGTCATCCTGGTCCTTGTGGTCTGCAAGAAGCTGAGGAGCATCACAGATGTATACCTCTTGAACCTGGCCCTGTCTGACCTGCTTTTTGTCTTCTCCTTCCCCTTTCAGACCTACTATCTGCTGGACCAGTGGGTGTTTGGGACTGTAATGTGCAAAGTGGTGTCTGGCTTTTATTACATTGGCTTCTACAGCAGCATGTTTTTCATCACCCTCATGAGTGTGGACAGGTACCTGGCTGTTGTCCATGCCGTGTATGCCCTAAAGGTGAGGACGATCAGGATGGGCACAACGCTGTGCCTGGCAGTATGGCTAACCGCCATTATGGCTACCATCCCATTGCTAGTGTTTTACCAAGTGGCCTCTGAAGATGGTGTTCTACAGTGTTATTCATTTTACAATCAACAGACTTTGAAGTGGAAGATCTTCACCAACTTCAAAATGAACATTTTAGGCTTGTTGATCCCATTCACCATCTTTATGTTCTGCTACATTAAAATCCTGCACCAGCTGAAGAGGTGTCAAAACCACAACAAGACCAAGGCCATCAGGTTGGTGCTCATTGTGGTCATTGCATCTTTACTTTTCTGGGTCCCATTCAACGTGGTTCTTTTCCTCACTTCCTTGCACAGTATGCACATCTTGGATGGATGTAGCATAAGCCAACAGCTGACTTATGCCACCCATGTCACAGAAATCATTTCCTTTACTCACTGCTGTGTGAACCCTGTTATCTATGCTTTTGTTGGGGAGAAGTTCAAGAAACACCTCTCAGAAATATTTCAGAAAAGTTGCAGCCAAATCTTCAACTACCTAGGAAGACAAATGCCTAGGGAGAGCTGTGAAAAGTCATCATCCTGCCAGCAGCACTCCTCCCGTTCCTCCAGCGTAGACTACATTTTGTGA
ORF Protein Sequence MDYTLDLSVTTVTDYYYPDIFSSPCDAELIQTNGKLLLAVFYCLLFVFSLLGNSLVILVLVVCKKLRSITDVYLLNLALSDLLFVFSFPFQTYYLLDQWVFGTVMCKVVSGFYYIGFYSSMFFITLMSVDRYLAVVHAVYALKVRTIRMGTTLCLAVWLTAIMATIPLLVFYQVASEDGVLQCYSFYNQQTLKWKIFTNFKMNILGLLIPFTIFMFCYIKILHQLKRCQNHNKTKAIRLVLIVVIASLLFWVPFNVVLFLTSLHSMHILDGCSISQQLTYATHVTEIISFTHCCVNPVIYAFVGEKFKKHLSEIFQKSCSQIFNYLGRQMPRESCEKSSSCQQHSSRSSSVDYIL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T20575-Ab Anti-CCR8/ CC-CKR-8/ CCR-8 monoclonal antibody
    Target Antigen GM-Tg-g-T20575-Ag CCR8 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T20575 chemokine (C-C motif) receptor 8 (CCR8) protein & antibody
    ORF Viral Vector pGMLP003581 Human CCR8 Lentivirus plasmid
    ORF Viral Vector vGMLP003581 Human CCR8 Lentivirus particle


    Target information

    Target ID GM-T20575
    Target Name CCR8
    Gene ID 1237, 12776, 693806, 301066, 101099650, 485600, 407772, 100055409
    Gene Symbol and Synonyms C-C,C-C CKR-8,CC-CKR-8,CCR-8,CCR8,CDw198,CKR-8,CKRL1,CMKBR8,CMKBRL2,CY6,GPRCY6,mCCR8,TER1
    Uniprot Accession P51685
    Uniprot Entry Name CCR8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000179934
    Target Classification GPCR

    This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.