Human SDC1/CD138/SDC ORF/cDNA clone-Lentivirus particle (NM_001006946)

Cat. No.: vGMLP003528

Pre-made Human SDC1/CD138/SDC Lentiviral expression plasmid for SDC1 lentivirus packaging, SDC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SDC1/CD138 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003528 Human SDC1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003528
Gene Name SDC1
Accession Number NM_001006946
Gene ID 6382
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 933 bp
Gene Alias CD138,SDC,SYND1,syndecan
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGCGCGCGGCGCTCTGGCTCTGGCTGTGCGCGCTGGCGCTGAGCCTGCAGCCGGCCCTGCCGCAAATTGTGGCTACTAATTTGCCCCCTGAAGATCAAGATGGCTCTGGGGATGACTCTGACAACTTCTCCGGCTCAGGTGCAGGTGCTTTGCAAGATATCACCTTGTCACAGCAGACCCCCTCCACTTGGAAGGACACGCAGCTCCTGACGGCTATTCCCACGTCTCCAGAACCCACCGGCCTGGAGGCTACAGCTGCCTCCACCTCCACCCTGCCGGCTGGAGAGGGGCCCAAGGAGGGAGAGGCTGTAGTCCTGCCAGAAGTGGAGCCTGGCCTCACCGCCCGGGAGCAGGAGGCCACCCCCCGACCCAGGGAGACCACACAGCTCCCGACCACTCATCTGGCCTCAACGACCACAGCCACCACGGCCCAGGAGCCCGCCACCTCCCACCCCCACAGGGACATGCAGCCTGGCCACCATGAGACCTCAACCCCTGCAGGACCCAGCCAAGCTGACCTTCACACTCCCCACACAGAGGATGGAGGTCCTTCTGCCACCGAGAGGGCTGCTGAGGATGGAGCCTCCAGTCAGCTCCCAGCAGCAGAGGGCTCTGGGGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACGGCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACGGGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGGAGGCCTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAGAAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAGAAGCCCACCAAACAGGAGGAATTCTATGCCTGA
ORF Protein Sequence MRRAALWLWLCALALSLQPALPQIVATNLPPEDQDGSGDDSDNFSGSGAGALQDITLSQQTPSTWKDTQLLTAIPTSPEPTGLEATAASTSTLPAGEGPKEGEAVVLPEVEPGLTAREQEATPRPRETTQLPTTHLASTTTATTAQEPATSHPHRDMQPGHHETSTPAGPSQADLHTPHTEDGGPSATERAAEDGASSQLPAAEGSGEQDFTFETSGENTAVVAVEPDRRNQSPVDQGATGASQGLLDRKEVLGGVIAGGLVGLIFAVCLVGFMLYRMKKKDEGSYSLEEPKQANGGAYQKPTKQEEFYA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-865 Pre-Made Indatuximab Ravtansine Biosimilar, Whole Mab Adc, Anti-Sdc1 Antibody: Anti-CD138/SDC/SYND1/syndecan therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-271 Pre-Made Indatuximab biosimilar, Whole mAb ADC, Anti-SDC1 Antibody: Anti-SDC/CD138/SYND1/syndecan therapeutic antibody
    Target Antibody GM-Tg-g-T13017-Ab Anti-SDC1/ CD138/ SDC monoclonal antibody
    Target Antigen GM-Tg-g-T13017-Ag SDC1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003528 Human SDC1 Lentivirus plasmid
    ORF Viral Vector pGMLP004053 Human SDC1 Lentivirus plasmid
    ORF Viral Vector vGMLP003528 Human SDC1 Lentivirus particle
    ORF Viral Vector vGMLP004053 Human SDC1 Lentivirus particle


    Target information

    Target ID GM-T13017
    Target Name SDC1
    Gene ID 6382, 20969, 701544, 25216, 101101459, 482986, 529759, 100071892
    Gene Symbol and Synonyms CD138,HSPG,SDC,SDC1,Sstn,syn-1,Synd,SYND1,SYNDECA,syndecan
    Uniprot Accession P18827
    Uniprot Entry Name SDC1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Ovary Cancer, myeloma patients, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000115884
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-1 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-1 expression has been detected in several different tumor types. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode the same protein. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.