Human FGF6/HBGF-6/HST2 ORF/cDNA clone-Lentivirus particle (NM_020996)

Cat. No.: vGMLP003448

Pre-made Human FGF6/HBGF-6/HST2 Lentiviral expression plasmid for FGF6 lentivirus packaging, FGF6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to FGF6/HBGF-6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003448 Human FGF6 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003448
Gene Name FGF6
Accession Number NM_020996
Gene ID 2251
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 627 bp
Gene Alias HBGF-6,HST2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCTGGGACAGAAACTGTTCATCACTATGTCCCGGGGAGCAGGACGTCTGCAGGGCACGCTGTGGGCTCTCGTCTTCCTAGGCATCCTAGTGGGCATGGTGGTGCCCTCGCCTGCAGGCACCCGTGCCAACAACACGCTGCTGGACTCGAGGGGCTGGGGCACCCTGCTGTCCAGGTCTCGCGCCGGGCTAGCTGGAGAGATTGCCGGGGTGAACTGGGAAAGTGGCTATTTGGTGGGGATCAAGCGGCAGCGGAGGCTCTACTGCAACGTGGGCATCGGCTTTCACCTCCAGGTGCTCCCCGACGGCCGGATCAGCGGGACCCACGAGGAGAACCCCTACAGCCTGCTGGAAATTTCCACTGTGGAGCGAGGCGTGGTGAGTCTCTTTGGAGTGAGAAGTGCCCTCTTCGTTGCCATGAACAGTAAAGGAAGATTGTACGCAACGCCCAGCTTCCAAGAAGAATGCAAGTTCAGAGAAACCCTCCTGCCCAACAATTACAATGCCTACGAGTCAGACTTGTACCAAGGGACCTACATTGCCCTGAGCAAATACGGACGGGTAAAGCGGGGCAGCAAGGTGTCCCCGATCATGACTGTCACTCATTTCCTTCCCAGGATCTAA
ORF Protein Sequence MALGQKLFITMSRGAGRLQGTLWALVFLGILVGMVVPSPAGTRANNTLLDSRGWGTLLSRSRAGLAGEIAGVNWESGYLVGIKRQRRLYCNVGIGFHLQVLPDGRISGTHEENPYSLLEISTVERGVVSLFGVRSALFVAMNSKGRLYATPSFQEECKFRETLLPNNYNAYESDLYQGTYIALSKYGRVKRGSKVSPIMTVTHFLPRI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0216-Ab Anti-FGF6/ HBGF-6/ HST2 functional antibody
    Target Antigen GM-Tg-g-SE0216-Ag FGF6 protein
    Cytokine cks-Tg-g-GM-SE0216 fibroblast growth factor 6 (FGF6) protein & antibody
    ORF Viral Vector pGMLP003448 Human FGF6 Lentivirus plasmid
    ORF Viral Vector vGMLP003448 Human FGF6 Lentivirus particle


    Target information

    Target ID GM-SE0216
    Target Name FGF6
    Gene ID 2251, 14177, 710739, 170700, 101091459, 486735, 540317, 100051221
    Gene Symbol and Synonyms Fgf-6,FGF6,Fgf7b,HBGF-6,HST2,HSTF-2
    Uniprot Accession P10767
    Uniprot Entry Name FGF6_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000111241
    Target Classification Not Available

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene displayed oncogenic transforming activity when transfected into mammalian cells. The mouse homolog of this gene exhibits a restricted expression profile predominantly in the myogenic lineage, which suggested a role in muscle regeneration or differentiation. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.