Human ARMCX3/ALEX3/ dJ545K15.2 ORF/cDNA clone-Lentivirus particle (NM_016607)

Pre-made Human ARMCX3/ALEX3/ dJ545K15.2 Lentiviral expression plasmid for ARMCX3 lentivirus packaging, ARMCX3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ARMCX3/ALEX3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003162 Human ARMCX3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003162
Gene Name ARMCX3
Accession Number NM_016607
Gene ID 51566
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1140 bp
Gene Alias ALEX3, dJ545K15.2, GASP6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCTACGCCAGGAAAGTAGGCTGGGTGACCGCAGGCCTGGTGATTGGGGCTGGCGCCTGCTATTGCATTTATAGACTGACTAGGGGAAGAAAACAGAACAAGGAAAAAATGGCTGAGGGTGGATCTGGGGATGTGGATGATGCTGGGGACTGTTCTGGGGCCAGGTATAATGACTGGTCTGATGATGATGATGACAGCAATGAGAGCAAGAGTATAGTATGGTACCCACCTTGGGCTCGGATTGGGACTGAAGCTGGAACCAGAGCTAGGGCCAGGGCAAGGGCCAGGGCTACCCGGGCACGTCGGGCTGTCCAGAAACGGGCTTCCCCCAATTCAGATGATACCGTTTTGTCCCCTCAAGAGCTACAAAAGGTTCTTTGCTTGGTTGAGATGTCTGAAAAGCCTTATATTCTTGAAGCAGCTTTAATTGCTCTGGGTAACAATGCTGCTTATGCATTTAACAGAGATATTATTCGTGATCTGGGTGGTCTCCCAATTGTCGCAAAGATTCTCAATACTCGGGATCCCATAGTTAAGGAAAAGGCTTTAATTGTCCTGAATAACTTGAGTGTGAATGCTGAAAATCAGCGCAGGCTTAAAGTATACATGAATCAAGTGTGTGATGACACAATCACTTCTCGCTTGAACTCATCTGTGCAGCTTGCTGGACTGAGATTGCTTACAAATATGACTGTTACTAATGAGTATCAGCACATGCTTGCTAATTCCATTTCTGACTTTTTTCGTTTATTTTCAGCGGGAAATGAAGAAACCAAACTTCAGGTTCTGAAACTCCTTTTGAATTTGGCTGAAAATCCAGCCATGACTAGGGAACTGCTCAGGGCCCAAGTACCATCTTCACTGGGCTCCCTCTTTAATAAGAAGGAGAACAAAGAAGTTATTCTTAAACTTCTGGTCATATTTGAGAACATAAATGATAATTTCAAATGGGAAGAAAATGAACCTACTCAGAATCAATTCGGTGAAGGTTCACTTTTTTTCTTTTTAAAAGAATTTCAAGTGTGTGCTGATAAGGTTCTGGGAATAGAAAGTCACCATGATTTTTTGGTGAAAGTAAAAGTTGGAAAATTCATGGCCAAACTTGCTGAACATATGTTCCCAAAGAGCCAGGAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0357-Ab Anti-ARMCX3 monoclonal antibody
    Target Antigen GM-Tg-g-IP0357-Ag ARMCX3 protein
    ORF Viral Vector pGMLV000430 Rat Armcx3 Lentivirus plasmid
    ORF Viral Vector pGMAD000278 Human ARMCX3 Adenovirus plasmid
    ORF Viral Vector pGMPC000010 Human ARMCX3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000045 Human ARMCX3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP003162 Human ARMCX3 Lentivirus plasmid
    ORF Viral Vector vGMLV000430 Rat Armcx3 Lentivirus particle
    ORF Viral Vector vGMAD000278 Human ARMCX3 Adenovirus particle
    ORF Viral Vector vGMLP003162 Human ARMCX3 Lentivirus particle


    Target information

    Target ID GM-IP0357
    Target Name ARMCX3
    Gene ID 51566, 71703, 704035, 367902, 101089083, 119868484, 516747, 100057749
    Gene Symbol and Synonyms 1200004E24Rik,ALEX3,ARMCX3,dJ545K15.2,GASP6
    Uniprot Accession Q9UH62
    Uniprot Entry Name ARMX3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000102401
    Target Classification Not Available

    This gene encodes a member of the ALEX family of proteins which may play a role in tumor suppression. The encoded protein contains a potential N-terminal transmembrane domain and a single Armadillo (arm) repeat. Other proteins containing the arm repeat are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is closely localized with other family members on the X chromosome. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.