Human ARMCX3/ALEX3/ dJ545K15.2 ORF/cDNA clone-Lentivirus particle (NM_016607)
Pre-made Human ARMCX3/ALEX3/ dJ545K15.2 Lentiviral expression plasmid for ARMCX3 lentivirus packaging, ARMCX3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to ARMCX3/ALEX3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003162 | Human ARMCX3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003162 |
Gene Name | ARMCX3 |
Accession Number | NM_016607 |
Gene ID | 51566 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1140 bp |
Gene Alias | ALEX3, dJ545K15.2, GASP6 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCTACGCCAGGAAAGTAGGCTGGGTGACCGCAGGCCTGGTGATTGGGGCTGGCGCCTGCTATTGCATTTATAGACTGACTAGGGGAAGAAAACAGAACAAGGAAAAAATGGCTGAGGGTGGATCTGGGGATGTGGATGATGCTGGGGACTGTTCTGGGGCCAGGTATAATGACTGGTCTGATGATGATGATGACAGCAATGAGAGCAAGAGTATAGTATGGTACCCACCTTGGGCTCGGATTGGGACTGAAGCTGGAACCAGAGCTAGGGCCAGGGCAAGGGCCAGGGCTACCCGGGCACGTCGGGCTGTCCAGAAACGGGCTTCCCCCAATTCAGATGATACCGTTTTGTCCCCTCAAGAGCTACAAAAGGTTCTTTGCTTGGTTGAGATGTCTGAAAAGCCTTATATTCTTGAAGCAGCTTTAATTGCTCTGGGTAACAATGCTGCTTATGCATTTAACAGAGATATTATTCGTGATCTGGGTGGTCTCCCAATTGTCGCAAAGATTCTCAATACTCGGGATCCCATAGTTAAGGAAAAGGCTTTAATTGTCCTGAATAACTTGAGTGTGAATGCTGAAAATCAGCGCAGGCTTAAAGTATACATGAATCAAGTGTGTGATGACACAATCACTTCTCGCTTGAACTCATCTGTGCAGCTTGCTGGACTGAGATTGCTTACAAATATGACTGTTACTAATGAGTATCAGCACATGCTTGCTAATTCCATTTCTGACTTTTTTCGTTTATTTTCAGCGGGAAATGAAGAAACCAAACTTCAGGTTCTGAAACTCCTTTTGAATTTGGCTGAAAATCCAGCCATGACTAGGGAACTGCTCAGGGCCCAAGTACCATCTTCACTGGGCTCCCTCTTTAATAAGAAGGAGAACAAAGAAGTTATTCTTAAACTTCTGGTCATATTTGAGAACATAAATGATAATTTCAAATGGGAAGAAAATGAACCTACTCAGAATCAATTCGGTGAAGGTTCACTTTTTTTCTTTTTAAAAGAATTTCAAGTGTGTGCTGATAAGGTTCTGGGAATAGAAAGTCACCATGATTTTTTGGTGAAAGTAAAAGTTGGAAAATTCATGGCCAAACTTGCTGAACATATGTTCCCAAAGAGCCAGGAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0357-Ab | Anti-ARMCX3 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0357-Ag | ARMCX3 protein |
ORF Viral Vector | pGMLV000430 | Rat Armcx3 Lentivirus plasmid |
ORF Viral Vector | pGMAD000278 | Human ARMCX3 Adenovirus plasmid |
ORF Viral Vector | pGMPC000010 | Human ARMCX3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000045 | Human ARMCX3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP003162 | Human ARMCX3 Lentivirus plasmid |
ORF Viral Vector | vGMLV000430 | Rat Armcx3 Lentivirus particle |
ORF Viral Vector | vGMAD000278 | Human ARMCX3 Adenovirus particle |
ORF Viral Vector | vGMLP003162 | Human ARMCX3 Lentivirus particle |
Target information
Target ID | GM-IP0357 |
Target Name | ARMCX3 |
Gene ID | 51566, 71703, 704035, 367902, 101089083, 119868484, 516747, 100057749 |
Gene Symbol and Synonyms | 1200004E24Rik,ALEX3,ARMCX3,dJ545K15.2,GASP6 |
Uniprot Accession | Q9UH62 |
Uniprot Entry Name | ARMX3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000102401 |
Target Classification | Not Available |
This gene encodes a member of the ALEX family of proteins which may play a role in tumor suppression. The encoded protein contains a potential N-terminal transmembrane domain and a single Armadillo (arm) repeat. Other proteins containing the arm repeat are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is closely localized with other family members on the X chromosome. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.