Human PF4V1/CXCL4L1/CXCL4V1 ORF/cDNA clone-Lentivirus particle (NM_002620)

Cat. No.: vGMLP003152

Pre-made Human PF4V1/CXCL4L1/CXCL4V1 Lentiviral expression plasmid for PF4V1 lentivirus packaging, PF4V1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PF4V1/CXCL4L1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003152 Human PF4V1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003152
Gene Name PF4V1
Accession Number NM_002620
Gene ID 5197
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 315 bp
Gene Alias CXCL4L1,CXCL4V1,PF4-ALT,PF4A,SCYB4V1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTCCGCAGCCAGGTCCCGCCTCACCCGCGCCACCCGCCAGGAGATGCTGTTCTTGGCGTTGCTGCTCCTGCCAGTTGTGGTCGCCTTCGCCAGAGCTGAAGCTGAAGAAGATGGGGACCTGCAGTGCCTGTGTGTGAAGACCACCTCCCAGGTCCGTCCCAGGCACATCACCAGCCTGGAGGTGATCAAGGCCGGACCCCACTGCCCCACTGCCCAACTCATAGCCACGCTGAAGAATGGGAGGAAAATTTGCTTGGATCTGCAAGCCCTGCTGTACAAGAAAATCATTAAGGAACATTTGGAGAGTTAG
ORF Protein Sequence MSSAARSRLTRATRQEMLFLALLLLPVVVAFARAEAEEDGDLQCLCVKTTSQVRPRHITSLEVIKAGPHCPTAQLIATLKNGRKICLDLQALLYKKIIKEHLES

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1179-Ab Anti-PF4V/ PF4V1/ CXCL4L1 functional antibody
    Target Antigen GM-Tg-g-SE1179-Ag PF4V1 protein
    ORF Viral Vector pGMLP003152 Human PF4V1 Lentivirus plasmid
    ORF Viral Vector pGMLV000280 Human PF4V1 Lentivirus plasmid
    ORF Viral Vector vGMLP003152 Human PF4V1 Lentivirus particle
    ORF Viral Vector vGMLV000280 Human PF4V1 Lentivirus particle


    Target information

    Target ID GM-SE1179
    Target Name PF4V1
    Gene ID 5197, 703895
    Gene Symbol and Synonyms CXCL4L1,CXCL4V1,PF4-ALT,PF4A,PF4V1,SCYB4V1
    Uniprot Accession P10720
    Uniprot Entry Name PF4V_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000109272
    Target Classification Not Available

    The protein encoded by this gene is a chemokine that is highly similar to platelet factor 4. The encoded protein displays a strong antiangiogenic function and is regulated by chemokine (C-X-C motif) receptor 3. This protein also impairs tumor growth and can protect against blood-retinal barrier breakdown in diabetes patients. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.