Human MANF/ARMET/ARP ORF/cDNA clone-Lentivirus particle (NM_006010)
SKU: vGMLP003144
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human MANF/ARMET/ARP Lentiviral expression plasmid for MANF lentivirus packaging, MANF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
ARMET/MANF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003144 | Human MANF Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003144 |
Gene Name | MANF |
Accession Number | NM_006010 |
Gene ID | 7873 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 558 bp |
Gene Alias | ARMET,ARP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGAGGATGAGGAGGATGTGGGCCACGCAGGGGCTGGCGGTGGCGCTGGCTCTGAGCGTGCTGCCGGGCAGCCGGGCGCTGCGGCCGGGCGACTGCGAAGTTTGTATTTCTTATCTGGGAAGATTTTACCAGGACCTCAAAGACAGAGATGTCACATTCTCACCAGCCACTATTGAAAACGAACTTATAAAGTTCTGCCGGGAAGCAAGAGGCAAAGAGAATCGGTTGTGCTACTATATCGGGGCCACAGATGATGCAGCCACCAAAATCATCAATGAGGTATCAAAGCCTCTGGCCCACCACATCCCTGTGGAGAAGATCTGTGAGAAGCTTAAGAAGAAGGACAGCCAGATATGTGAGCTTAAGTATGACAAGCAGATCGACCTGAGCACAGTGGACCTGAAGAAGCTCCGAGTTAAAGAGCTGAAGAAGATTCTGGATGACTGGGGGGAGACATGCAAAGGCTGTGCAGAAAAGTCTGACTACATCCGGAAGATAAATGAACTGATGCCTAAATATGCCCCCAAGGCAGCCAGTGCACGGACCGATTTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T62415-Ab | Anti-MANF/ ARMET/ ARP functional antibody |
Target Antigen | GM-Tg-g-T62415-Ag | ARMET/MANF protein |
ORF Viral Vector | pGMLP003144 | Human MANF Lentivirus plasmid |
ORF Viral Vector | pGMLV000199 | Human MANF Lentivirus plasmid |
ORF Viral Vector | pGMLV000783 | Human MANF Lentivirus plasmid |
ORF Viral Vector | vGMLP003144 | Human MANF Lentivirus particle |
ORF Viral Vector | vGMLV000199 | Human MANF Lentivirus particle |
ORF Viral Vector | vGMLV000783 | Human MANF Lentivirus particle |
Target information
Target ID | GM-T62415 |
Target Name | ARMET |
Gene ID | 7873, 74840, 700659, 315989, 101090926, 100855747, 540432, 100052301 |
Gene Symbol and Synonyms | 3230402M22Rik,ARMET,ARP,D18Mgi17,MANF |
Uniprot Accession | P55145 |
Uniprot Entry Name | MANF_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000145050 |
Target Classification | Not Available |
The protein encoded by this gene is localized in the endoplasmic reticulum (ER) and golgi, and is also secreted. Reducing expression of this gene increases susceptibility to ER stress-induced death and results in cell proliferation. Activity of this protein is important in promoting the survival of dopaminergic neurons. The presence of polymorphisms in the N-terminal arginine-rich region, including a specific mutation that changes an ATG start codon to AGG, have been reported in a variety of solid tumors; however, these polymorphisms were later shown to exist in normal tissues and are thus no longer thought to be tumor-related. [provided by RefSeq, Apr 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.