Human SLURP1/ANUP/ ARS ORF/cDNA clone-Lentivirus particle (NM_020427)

Pre-made Human SLURP1/ANUP/ ARS Lentiviral expression plasmid for SLURP1 lentivirus packaging, SLURP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SLURP1/ANUP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002989 Human SLURP1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002989
Gene Name SLURP1
Accession Number NM_020427
Gene ID 57152
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 312 bp
Gene Alias ANUP, ARS, ArsB, LY6LS, MDM
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCTCTCGCTGGGCTGTGCAGCTGCTGCTCGTGGCAGCCTGGAGCATGGGCTGTGGTGAGGCCCTCAAGTGCTACACCTGCAAGGAGCCCATGACCAGTGCTTCCTGCAGGACCATTACCCGCTGCAAGCCAGAGGACACAGCCTGCATGACCACGCTGGTGACGGTGGAGGCAGAGTACCCCTTCAACCAGAGCCCCGTGGTGACCCGCTCCTGCTCCAGCTCCTGTGTGGCCACCGACCCCGACAGCATCGGGGCCGCCCACCTGATCTTCTGCTGCTTCCGAGACCTCTGCAACTCGGAACTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1293-Ab Anti-SLUR1/ SLURP1/ ANUP functional antibody
    Target Antigen GM-Tg-g-SE1293-Ag SLURP1 protein
    ORF Viral Vector pGMLP002989 Human SLURP1 Lentivirus plasmid
    ORF Viral Vector vGMLP002989 Human SLURP1 Lentivirus particle


    Target information

    Target ID GM-SE1293
    Target Name SLURP1
    Gene ID 57152, 57277, 114669800, 300016, 101087204, 482069, 618706
    Gene Symbol and Synonyms 1110021N19Rik,ANUP,ARS,ArsB,LY6-MT,LY6LS,MDM,RGD1308768,Slurp-1,SLURP1
    Uniprot Accession P55000
    Uniprot Entry Name SLUR1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000126233
    Target Classification Not Available

    The protein encoded by this gene is a member of the Ly6/uPAR family but lacks a GPI-anchoring signal sequence. It is thought that this secreted protein contains antitumor activity. Mutations in this gene have been associated with Mal de Meleda, a rare autosomal recessive skin disorder. This gene maps to the same chromosomal region as several members of the Ly6/uPAR family of glycoprotein receptors. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.