Human SLURP1/ANUP/ ARS ORF/cDNA clone-Lentivirus particle (NM_020427)
Pre-made Human SLURP1/ANUP/ ARS Lentiviral expression plasmid for SLURP1 lentivirus packaging, SLURP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SLURP1/ANUP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002989 | Human SLURP1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002989 |
Gene Name | SLURP1 |
Accession Number | NM_020427 |
Gene ID | 57152 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 312 bp |
Gene Alias | ANUP, ARS, ArsB, LY6LS, MDM |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCTCTCGCTGGGCTGTGCAGCTGCTGCTCGTGGCAGCCTGGAGCATGGGCTGTGGTGAGGCCCTCAAGTGCTACACCTGCAAGGAGCCCATGACCAGTGCTTCCTGCAGGACCATTACCCGCTGCAAGCCAGAGGACACAGCCTGCATGACCACGCTGGTGACGGTGGAGGCAGAGTACCCCTTCAACCAGAGCCCCGTGGTGACCCGCTCCTGCTCCAGCTCCTGTGTGGCCACCGACCCCGACAGCATCGGGGCCGCCCACCTGATCTTCTGCTGCTTCCGAGACCTCTGCAACTCGGAACTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1293-Ab | Anti-SLUR1/ SLURP1/ ANUP functional antibody |
Target Antigen | GM-Tg-g-SE1293-Ag | SLURP1 protein |
ORF Viral Vector | pGMLP002989 | Human SLURP1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002989 | Human SLURP1 Lentivirus particle |
Target information
Target ID | GM-SE1293 |
Target Name | SLURP1 |
Gene ID | 57152, 57277, 114669800, 300016, 101087204, 482069, 618706 |
Gene Symbol and Synonyms | 1110021N19Rik,ANUP,ARS,ArsB,LY6-MT,LY6LS,MDM,RGD1308768,Slurp-1,SLURP1 |
Uniprot Accession | P55000 |
Uniprot Entry Name | SLUR1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000126233 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the Ly6/uPAR family but lacks a GPI-anchoring signal sequence. It is thought that this secreted protein contains antitumor activity. Mutations in this gene have been associated with Mal de Meleda, a rare autosomal recessive skin disorder. This gene maps to the same chromosomal region as several members of the Ly6/uPAR family of glycoprotein receptors. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.