Human LY86/dJ80N2.1/MD-1 ORF/cDNA clone-Lentivirus particle (NM_004271)

Cat. No.: vGMLP002684

Pre-made Human LY86/dJ80N2.1/MD-1 Lentiviral expression plasmid for LY86 lentivirus packaging, LY86 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to LY86/dJ80N2.1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002684 Human LY86 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002684
Gene Name LY86
Accession Number NM_004271
Gene ID 9450
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 489 bp
Gene Alias dJ80N2.1,MD-1,MD1,MMD-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGGGTTTCACAGCCACTCTCTTCCTCTGGACTCTGATTTTTCCCAGCTGCAGTGGAGGCGGCGGTGGGAAAGCCTGGCCCACACACGTGGTCTGTAGCGACAGCGGCTTGGAAGTGCTCTACCAGAGTTGCGATCCATTACAAGATTTTGGCTTTTCTGTTGAAAAGTGTTCCAAGCAATTAAAATCAAATATCAACATTAGATTTGGAATTATTCTGAGAGAGGACATCAAAGAGCTTTTTCTTGACCTAGCTCTCATGTCTCAAGGCTCATCTGTTTTGAATTTCTCCTATCCCATCTGTGAGGCGGCTCTGCCCAAGTTTTCTTTCTGTGGAAGAAGGAAAGGAGAGCAGATTTACTATGCTGGGCCTGTCAATAATCCTGAATTTACTATTCCTCAGGGAGAATACCAGGTTTTGCTGGAACTGTACACTGAAAAACGGTCCACCGTGGCCTGTGCCAATGCTACTATCATGTGCTCCTGA
ORF Protein Sequence MKGFTATLFLWTLIFPSCSGGGGGKAWPTHVVCSDSGLEVLYQSCDPLQDFGFSVEKCSKQLKSNINIRFGIILREDIKELFLDLALMSQGSSVLNFSYPICEAALPKFSFCGRRKGEQIYYAGPVNNPEFTIPQGEYQVLLELYTEKRSTVACANATIMCS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0331-Ab Anti-LY86/ MD-1/ MD1 functional antibody
    Target Antigen GM-Tg-g-SE0331-Ag LY86 protein
    ORF Viral Vector pGMLP002684 Human LY86 Lentivirus plasmid
    ORF Viral Vector vGMLP002684 Human LY86 Lentivirus particle


    Target information

    Target ID GM-SE0331
    Target Name LY86
    Gene ID 9450, 17084, 711507, 291359, 101100719, 478712, 613856, 100630498
    Gene Symbol and Synonyms dJ80N2.1,LY86,ly86_tv2,MD-1,MD1,MMD-1
    Uniprot Accession O95711
    Uniprot Entry Name LY86_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000112799
    Target Classification Not Available

    Acts upstream of or within positive regulation of lipopolysaccharide-mediated signaling pathway. Predicted to be located in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.