Human CAPG/AFCP/HEL-S-66 ORF/cDNA clone-Lentivirus particle (NM_001747)

Cat. No.: vGMLP002490

Pre-made Human CAPG/AFCP/HEL-S-66 Lentiviral expression plasmid for CAPG lentivirus packaging, CAPG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CAPG/AFCP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002490 Human CAPG Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002490
Gene Name CAPG
Accession Number NM_001747
Gene ID 822
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1047 bp
Gene Alias AFCP,HEL-S-66,MCP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTACACAGCCATTCCCCAGAGTGGCTCTCCATTCCCAGGCTCAGTGCAGGATCCAGGCCTGCATGTGTGGCGGGTGGAGAAGCTGAAGCCGGTGCCTGTGGCGCAAGAGAACCAGGGCGTCTTCTTCTCGGGGGACTCCTACCTAGTGCTGCACAATGGCCCAGAAGAGGTTTCCCATCTGCACCTGTGGATAGGCCAGCAGTCATCCCGGGATGAGCAGGGGGCCTGTGCCGTGCTGGCTGTGCACCTCAACACGCTGCTGGGAGAGCGGCCTGTGCAGCACCGCGAGGTGCAGGGCAATGAGTCTGACCTCTTCATGAGCTACTTCCCACGGGGCCTCAAGTACCAGGAAGGTGGTGTGGAGTCAGCATTTCACAAGACCTCCACAGGAGCCCCAGCTGCCATCAAGAAACTCTACCAGGTGAAGGGGAAGAAGAACATCCGTGCCACCGAGCGGGCACTGAACTGGGACAGCTTCAACACTGGGGACTGCTTCATCCTGGACCTGGGCCAGAACATCTTCGCCTGGTGTGGTGGAAAGTCCAACATCCTGGAACGCAACAAGGCGAGGGACCTGGCCCTGGCCATCCGGGACAGTGAGCGACAGGGCAAGGCCCAGGTGGAGATTGTCACTGATGGGGAGGAGCCTGCTGAGATGATCCAGGTCCTGGGCCCCAAGCCTGCTCTGAAGGAGGGCAACCCTGAGGAAGACCTCACAGCTGACAAGGCAAATGCCCAGGCCGCAGCTCTGTATAAGGTCTCTGATGCCACTGGACAGATGAACCTGACCAAGGTGGCTGACTCCAGCCCATTTGCCCTTGAACTGCTGATATCTGATGACTGCTTTGTGCTGGACAACGGGCTCTGTGGCAAGATCTATATCTGGAAGGGGCGAAAAGCGAATGAGAAGGAGCGGCAGGCAGCCCTGCAGGTGGCCGAGGGCTTCATCTCGCGCATGCAGTACGCCCCGAACACTCAGGTGGAGATTCTGCCTCAGGGCCATGAGAGTCCCATCTTCAAGCAATTTTTCAAGGACTGGAAATGA
ORF Protein Sequence MYTAIPQSGSPFPGSVQDPGLHVWRVEKLKPVPVAQENQGVFFSGDSYLVLHNGPEEVSHLHLWIGQQSSRDEQGACAVLAVHLNTLLGERPVQHREVQGNESDLFMSYFPRGLKYQEGGVESAFHKTSTGAPAAIKKLYQVKGKKNIRATERALNWDSFNTGDCFILDLGQNIFAWCGGKSNILERNKARDLALAIRDSERQGKAQVEIVTDGEEPAEMIQVLGPKPALKEGNPEEDLTADKANAQAAALYKVSDATGQMNLTKVADSSPFALELLISDDCFVLDNGLCGKIYIWKGRKANEKERQAALQVAEGFISRMQYAPNTQVEILPQGHESPIFKQFFKDWK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1406-Ab Anti-CAPG/ AFCP/ HEL-S-66 functional antibody
    Target Antigen GM-Tg-g-SE1406-Ag CAPG protein
    ORF Viral Vector pGMLP002490 Human CAPG Lentivirus plasmid
    ORF Viral Vector vGMLP002490 Human CAPG Lentivirus particle


    Target information

    Target ID GM-SE1406
    Target Name CAPG
    Gene ID 822, 12332, 695288, 297339, 101084952, 483082, 353121, 100053297
    Gene Symbol and Synonyms AFCP,CAPG,gCap39,HEL-S-66,mbh1,MCP
    Uniprot Accession P40121
    Uniprot Entry Name CAPG_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000042493
    Target Classification Not Available

    This gene encodes a member of the gelsolin/villin family of actin-regulatory proteins. The encoded protein reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, the encoded protein contributes to the control of actin-based motility in non-muscle cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.