Human GJB5/CX31.1 ORF/cDNA clone-Lentivirus particle (NM_005268)

Cat. No.: vGMLP002458

Pre-made Human GJB5/CX31.1 Lentiviral expression plasmid for GJB5 lentivirus packaging, GJB5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to Cx31.1/GJB5/CX31.1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002458 Human GJB5 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002458
Gene Name GJB5
Accession Number NM_005268
Gene ID 2709
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 822 bp
Gene Alias CX31.1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACTGGAGTATCTTTGAGGGACTCCTGAGTGGGGTCAACAAGTACTCCACAGCCTTTGGGCGCATCTGGCTGTCTCTGGTCTTCATCTTCCGCGTGCTGGTGTACCTGGTGACGGCCGAGCGTGTGTGGAGTGATGACCACAAGGACTTCGACTGCAATACTCGCCAGCCCGGCTGCTCCAACGTCTGCTTTGATGAGTTCTTCCCTGTGTCCCATGTGCGCCTCTGGGCCCTGCAGCTTATCCTGGTGACATGCCCCTCACTGCTCGTGGTCATGCACGTGGCCTACCGGGAGGTTCAGGAGAAGAGGCACCGAGAAGCCCATGGGGAGAACAGTGGGCGCCTCTACCTGAACCCCGGCAAGAAGCGGGGTGGGCTCTGGTGGACATATGTCTGCAGCCTAGTGTTCAAGGCGAGCGTGGACATCGCCTTTCTCTATGTGTTCCACTCATTCTACCCCAAATATATCCTCCCTCCTGTGGTCAAGTGCCACGCAGATCCATGTCCCAATATAGTGGACTGCTTCATCTCCAAGCCCTCAGAGAAGAACATTTTCACCCTCTTCATGGTGGCCACAGCTGCCATCTGCATCCTGCTCAACCTCGTGGAGCTCATCTACCTGGTGAGCAAGAGATGCCACGAGTGCCTGGCAGCAAGGAAAGCTCAAGCCATGTGCACAGGTCATCACCCCCACGGTACCACCTCTTCCTGCAAACAAGACGACCTCCTTTCGGGTGACCTCATCTTTCTGGGCTCAGACAGTCATCCTCCTCTCTTACCAGACCGCCCCCGAGACCATGTGAAGAAAACCATCTTGTGA
ORF Protein Sequence MNWSIFEGLLSGVNKYSTAFGRIWLSLVFIFRVLVYLVTAERVWSDDHKDFDCNTRQPGCSNVCFDEFFPVSHVRLWALQLILVTCPSLLVVMHVAYREVQEKRHREAHGENSGRLYLNPGKKRGGLWWTYVCSLVFKASVDIAFLYVFHSFYPKYILPPVVKCHADPCPNIVDCFISKPSEKNIFTLFMVATAAICILLNLVELIYLVSKRCHECLAARKAQAMCTGHHPHGTTSSCKQDDLLSGDLIFLGSDSHPPLLPDRPRDHVKKTIL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0172-Ab Anti-Cx31.1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0172-Ag Cx31.1/GJB5 protein
    ORF Viral Vector pGMLP002458 Human GJB5 Lentivirus plasmid
    ORF Viral Vector vGMLP002458 Human GJB5 Lentivirus particle


    Target information

    Target ID GM-IP0172
    Target Name Cx31.1
    Gene ID 2709, 14622, 711078, 29586, 101083279, 482488, 524030, 100055619
    Gene Symbol and Synonyms Cnx31.1,CX31.1,Cxna,Gjb-5,GJB5
    Uniprot Accession O95377
    Uniprot Entry Name CXB5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000189280
    Target Classification Not Available

    This gene encodes a member of the beta-type (group I) connexin family. The encoded protein is a gap junction protein involved in intercellular communication related to epidermal differentiation and environmental sensing. This gene has been linked to non-small cell lung cancer. [provided by RefSeq, Nov 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.