Human B4GALT1/B4GAL-T1/ beta4Gal-T1 ORF/cDNA clone-Lentivirus particle (NM_001497)

Pre-made Human B4GALT1/B4GAL-T1/ beta4Gal-T1 Lentiviral expression plasmid for B4GALT1 lentivirus packaging, B4GALT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to B4GALT1/B4GAL-T1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002366 Human B4GALT1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002366
Gene Name B4GALT1
Accession Number NM_001497
Gene ID 2683
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1197 bp
Gene Alias B4GAL-T1, beta4Gal-T1, CDG2D, GGTB2, GT1, GTB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGCTTCGGGAGCCGCTCCTGAGCGGCAGCGCCGCGATGCCAGGCGCGTCCCTACAGCGGGCCTGCCGCCTGCTCGTGGCCGTCTGCGCTCTGCACCTTGGCGTCACCCTCGTTTACTACCTGGCTGGCCGCGACCTGAGCCGCCTGCCCCAACTGGTCGGAGTCTCCACACCGCTGCAGGGCGGCTCGAACAGTGCCGCCGCCATCGGGCAGTCCTCCGGGGAGCTCCGGACCGGAGGGGCCCGGCCGCCGCCTCCTCTAGGCGCCTCCTCCCAGCCGCGCCCGGGTGGCGACTCCAGCCCAGTCGTGGATTCTGGCCCTGGCCCCGCTAGCAACTTGACCTCGGTCCCAGTGCCCCACACCACCGCACTGTCGCTGCCCGCCTGCCCTGAGGAGTCCCCGCTGCTTGTGGGCCCCATGCTGATTGAGTTTAACATGCCTGTGGACCTGGAGCTCGTGGCAAAGCAGAACCCAAATGTGAAGATGGGCGGCCGCTATGCCCCCAGGGACTGCGTCTCTCCTCACAAGGTGGCCATCATCATTCCATTCCGCAACCGGCAGGAGCACCTCAAGTACTGGCTATATTATTTGCACCCAGTCCTGCAGCGCCAGCAGCTGGACTATGGCATCTATGTTATCAACCAGGCGGGAGACACTATATTCAATCGTGCTAAGCTCCTCAATGTTGGCTTTCAAGAAGCCTTGAAGGACTATGACTACACCTGCTTTGTGTTTAGTGACGTGGACCTCATTCCAATGAATGACCATAATGCGTACAGGTGTTTTTCACAGCCACGGCACATTTCCGTTGCAATGGATAAGTTTGGATTCAGCCTACCTTATGTTCAGTATTTTGGAGGTGTCTCTGCTCTAAGTAAACAACAGTTTCTAACCATCAATGGATTTCCTAATAATTATTGGGGCTGGGGAGGAGAAGATGATGACATTTTTAACAGATTAGTTTTTAGAGGCATGTCTATATCTCGCCCAAATGCTGTGGTCGGGAGGTGTCGCATGATCCGCCACTCAAGAGACAAGAAAAATGAACCCAATCCTCAGAGGTTTGACCGAATTGCACACACAAAGGAGACAATGCTCTCTGATGGTTTGAACTCACTCACCTACCAGGTGCTGGATGTACAGAGATACCCATTGTATACCCAAATCACAGTGGACATCGGGACACCGAGCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0129-Ab Anti-B4GT1/ B4GALT1/ B4GAL-T1 monoclonal antibody
    Target Antigen GM-Tg-g-MP0129-Ag B4GALT1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002366 Human B4GALT1 Lentivirus plasmid
    ORF Viral Vector vGMLP002366 Human B4GALT1 Lentivirus particle


    Target information

    Target ID GM-MP0129
    Target Name B4GALT1
    Gene ID 2683, 14595, 703541, 24390, 101100927, 481579, 281781, 100068209
    Gene Symbol and Synonyms 4-GalT,4-GalT1,B-1,B4GAL-T1,B4GALT1,beta-1,beta4Gal-T1,CDG2D,CLDLFIB,GalT,Ggtb,GGTB2,GT1,GTB
    Uniprot Accession P15291
    Uniprot Entry Name B4GT1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000086062
    Target Classification Not Available

    This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene is unique among the beta4GalT genes because it encodes an enzyme that participates both in glycoconjugate and lactose biosynthesis. For the first activity, the enzyme adds galactose to N-acetylglucosamine residues that are either monosaccharides or the nonreducing ends of glycoprotein carbohydrate chains. The second activity is restricted to lactating mammary tissues where the enzyme forms a heterodimer with alpha-lactalbumin to catalyze UDP-galactose + D-glucose <=> UDP + lactose. The two enzymatic forms result from alternate transcription initiation sites and post-translational processing. Two transcripts, which differ only at the 5' end, with approximate lengths of 4.1 kb and 3.9 kb encode the same protein. The longer transcript encodes the type II membrane-bound, trans-Golgi resident protein involved in glycoconjugate biosynthesis. The shorter transcript encodes a protein which is cleaved to form the soluble lactose synthase. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.