Human CEACAM7/CGM2ORF/cDNA clone-Lentivirus particle (NM_006890)

SKU: vGMLP002341
Size: 10 µg
Leading Time: 3-7 working days

Pre-made Human CEACAM7/CGM2 Lentiviral expression plasmid for CEACAM7 lentivirus packaging, CEACAM7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CEACAM7/CGM2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002341 Human CEACAM7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002341
Gene Name CEACAM7
Accession Number NM_006890
Gene ID 1087
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 798 bp
Gene Alias CGM2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGTCCCCTTCAGCCTGTCCATACAGAGTGTGCATTCCCTGGCAGGGGCTCCTGCTCACAGCCTCGCTTTTAACCTTCTGGAACCTGCCAAACAGTGCCCAGACCAATATTGATGTCGTGCCGTTCAATGTCGCAGAAGGGAAGGAGGTCCTTCTAGTAGTCCATAATGAGTCCCAGAATCTTTATGGCTACAACTGGTACAAAGGGGAAAGGGTGCATGCCAACTATCGAATTATAGGATATGTAAAAAATATAAGTCAAGAAAATGCCCCAGGGCCCGCACACAACGGTCGAGAGACAATATACCCCAATGGAACCCTGCTGATCCAGAACGTCACCCACAATGACGCAGGAATCTATACCCTACACGTTATAAAAGAAAATCTTGTGAATGAAGAAGTAACCAGACAATTCTACGTATTCTCGGAGCCACCCAAGCCCTCCATCACCAGCAACAACTTCAATCCGGTGGAGAACAAAGATATTGTGGTTTTAACCTGTCAACCTGAGACTCAGAACACAACCTACCTGTGGTGGGTAAACAATCAGAGCCTCCTGGTCAGTCCCAGGCTGCTGCTCTCCACTGACAACAGGACCCTCGTTCTACTCAGCGCCACAAAGAATGACATAGGACCCTATGAATGTGAAATACAGAACCCAGTGGGTGCCAGCCGCAGTGACCCAGTCACCCTGAATGTCCGCTATGAGTCAGTACAAGCAAGTTCACCTGACCTCTCAGCTGGGACCGCTGTCAGCATCATGATTGGAGTACTGGCTGGGATGGCTCTGATATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0249-Ab Anti-CEAM7/ CEACAM7/ CGM2 monoclonal antibody
    Target Antigen GM-Tg-g-MP0249-Ag CEACAM7 VLP (virus-like particle)
    ORF Viral Vector pGMLP002341 Human CEACAM7 Lentivirus plasmid
    ORF Viral Vector vGMLP002341 Human CEACAM7 Lentivirus particle


    Target information

    Target ID GM-MP0249
    Target Name CEACAM7
    Gene ID 1087, 705572
    Gene Symbol and Synonyms CEACAM7,CGM2
    Uniprot Accession Q14002
    Uniprot Entry Name CEAM7_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000007306
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a cell surface glycoprotein and member of the carcinoembryonic antigen (CEA) family of proteins. Expression of this gene may be downregulated in colon and rectal cancer. Additionally, lower expression levels of this gene may be predictive of rectal cancer recurrence. This gene is present in a CEA family gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.