Human STC1/STC ORF/cDNA clone-Lentivirus particle (NM_003155)
Pre-made Human STC1/STC Lentiviral expression plasmid for STC1 lentivirus packaging, STC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to STC1/STC products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002331 | Human STC1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002331 |
Gene Name | STC1 |
Accession Number | NM_003155 |
Gene ID | 6781 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 744 bp |
Gene Alias | STC |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTCCAAAACTCAGCAGTGCTTCTGGTGCTGGTGATCAGTGCTTCTGCAACCCATGAGGCGGAGCAGAATGACTCTGTGAGCCCCAGGAAATCCCGAGTGGCGGCTCAAAACTCAGCTGAAGTGGTTCGTTGCCTCAACAGTGCTCTACAGGTCGGCTGCGGGGCTTTTGCATGCCTGGAAAACTCCACCTGTGACACAGATGGGATGTATGACATCTGTAAATCCTTCTTGTACAGCGCTGCTAAATTTGACACTCAGGGAAAAGCATTCGTCAAAGAGAGCTTAAAATGCATCGCCAACGGGGTCACCTCCAAGGTCTTCCTCGCCATTCGGAGGTGCTCCACTTTCCAAAGGATGATTGCTGAGGTGCAGGAAGAGTGCTACAGCAAGCTGAATGTGTGCAGCATCGCCAAGCGGAACCCTGAAGCCATCACTGAGGTCGTCCAGCTGCCCAATCACTTCTCCAACAGATACTATAACAGACTTGTCCGAAGCCTGCTGGAATGTGATGAAGACACAGTCAGCACAATCAGAGACAGCCTGATGGAGAAAATTGGGCCTAACATGGCCAGCCTCTTCCACATCCTGCAGACAGACCACTGTGCCCAAACACACCCACGAGCTGACTTCAACAGGAGACGCACCAATGAGCCGCAGAAGCTGAAAGTCCTCCTCAGGAACCTCCGAGGTGAGGAGGACTCTCCCTCCCACATCAAACGCACATCCCATGAGAGTGCATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T30035-Ab | Anti-STC1/ STC functional antibody |
Target Antigen | GM-Tg-g-T30035-Ag | STC1 protein |
ORF Viral Vector | pGMLP002331 | Human STC1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002331 | Human STC1 Lentivirus particle |
Target information
Target ID | GM-T30035 |
Target Name | STC1 |
Gene ID | 6781, 20855, 710782, 81801, 101083584, 486112, 338078, 100054071 |
Gene Symbol and Synonyms | STC,STC1 |
Uniprot Accession | P52823 |
Uniprot Entry Name | STC1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000159167 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.