Human KLK13/KLK-L4/KLKL4 ORF/cDNA clone-Lentivirus particle (NM_015596)

Cat. No.: vGMLP002257

Pre-made Human KLK13/KLK-L4/KLKL4 Lentiviral expression plasmid for KLK13 lentivirus packaging, KLK13 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to KLK13/KLK-L4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002257 Human KLK13 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002257
Gene Name KLK13
Accession Number NM_015596
Gene ID 26085
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 834 bp
Gene Alias KLK-L4,KLKL4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGCCCCTGGCCCTAGTGATCGCCTCCCTGACCTTGGCCTTGTCAGGAGGTGTCTCCCAGGAGTCTTCCAAGGTTCTCAACACCAATGGGACCAGTGGGTTTCTCCCAGGTGGCTACACCTGCTTCCCCCACTCTCAGCCCTGGCAGGCTGCCCTACTAGTGCAAGGGCGGCTACTCTGTGGGGGAGTCCTGGTCCACCCCAAATGGGTCCTCACTGCCGCACACTGTCTAAAGGAGGGGCTCAAAGTTTACCTAGGCAAGCACGCCCTAGGGCGTGTGGAAGCTGGTGAGCAGGTGAGGGAAGTTGTCCACTCTATCCCCCACCCTGAATACCGGAGAAGCCCCACCCACCTGAACCACGACCATGACATCATGCTTCTGGAGCTGCAGTCCCCGGTCCAGCTCACAGGCTACATCCAAACCCTGCCCCTTTCCCACAACAACCGCCTAACCCCTGGCACCACCTGTCGGGTGTCTGGCTGGGGCACCACCACCAGCCCCCAGGTGAATTACCCCAAAACTCTACAATGTGCCAACATCCAACTTCGCTCAGATGAGGAGTGTCGTCAAGTCTACCCAGGAAAGATCACTGACAACATGTTGTGTGCCGGCACAAAAGAGGGTGGCAAAGACTCCTGTGAGGGTGACTCTGGGGGCCCCCTGGTCTGTAACAGAACACTGTATGGCATCGTCTCCTGGGGAGACTTCCCATGTGGGCAACCTGACCGGCCTGGTGTCTACACCCGTGTCTCAAGATACGTCCTGTGGATCCGTGAAACAATCCGAAAATATGAAACCCAGCAGCAAAAATGGTTGAAGGGCCCACAATAA
ORF Protein Sequence MWPLALVIASLTLALSGGVSQESSKVLNTNGTSGFLPGGYTCFPHSQPWQAALLVQGRLLCGGVLVHPKWVLTAAHCLKEGLKVYLGKHALGRVEAGEQVREVVHSIPHPEYRRSPTHLNHDHDIMLLELQSPVQLTGYIQTLPLSHNNRLTPGTTCRVSGWGTTTSPQVNYPKTLQCANIQLRSDEECRQVYPGKITDNMLCAGTKEGGKDSCEGDSGGPLVCNRTLYGIVSWGDFPCGQPDRPGVYTRVSRYVLWIRETIRKYETQQQKWLKGPQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1050-Ab Anti-KLK13/ KLK-L4/ KLKL4 functional antibody
    Target Antigen GM-Tg-g-SE1050-Ag KLK13 protein
    ORF Viral Vector pGMLP002257 Human KLK13 Lentivirus plasmid
    ORF Viral Vector vGMLP002257 Human KLK13 Lentivirus particle


    Target information

    Target ID GM-SE1050
    Target Name KLK13
    Gene ID 26085, 626834, 106994830, 292848, 102902318, 100856194, 540297, 100067063
    Gene Symbol and Synonyms Egfbp-2,KLK-L4,KLK13,KLKL4,Klnl,mGk-13
    Uniprot Accession Q9UKR3
    Uniprot Entry Name KLK13_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000167759
    Target Classification Not Available

    Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. [provided by RefSeq, Jan 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.