Human AGTR2/AT2/ATGR2 ORF/cDNA clone-Lentivirus particle (NM_000686.4)

Cat. No.: vGMLP002255

Pre-made Human AGTR2/AT2/ATGR2 Lentiviral expression plasmid for AGTR2 lentivirus packaging, AGTR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AGTR2/AT2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002255 Human AGTR2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002255
Gene Name AGTR2
Accession Number NM_000686.4
Gene ID 186
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1092 bp
Gene Alias AT2,ATGR2,MRX88
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGGGCAACTCCACCCTTGCCACTACTAGCAAAAACATTACCAGCGGTCTTCACTTCGGGCTTGTGAACATCTCTGGCAACAATGAGTCTACCTTGAACTGTTCACAGAAACCATCAGATAAGCATTTAGATGCAATTCCTATTCTTTACTACATTATATTTGTAATTGGATTTCTGGTCAATATTGTCGTGGTTACACTGTTTTGTTGTCAAAAGGGTCCTAAAAAGGTTTCTAGCATATACATCTTCAACCTCGCTGTGGCTGATTTACTCCTTTTGGCTACTCTTCCTCTATGGGCAACCTATTATTCTTATAGATATGACTGGCTCTTTGGACCTGTGATGTGCAAAGTTTTTGGTTCTTTTCTTACCCTGAACATGTTTGCAAGCATTTTTTTTATCACCTGCATGAGTGTTGATAGGTACCAATCTGTCATCTACCCCTTTCTGTCTCAAAGAAGAAATCCCTGGCAAGCATCTTATATAGTTCCCCTTGTTTGGTGTATGGCCTGTTTGTCCTCATTGCCAACATTTTATTTTCGAGACGTCAGAACCATTGAATACTTAGGAGTGAATGCTTGCATTATGGCTTTCCCACCTGAGAAATATGCCCAATGGTCAGCTGGGATTGCCTTAATGAAAAATATCCTTGGTTTTATTATCCCTTTAATATTCATAGCAACATGCTATTTTGGAATTAGAAAACACTTACTGAAGACGAATAGCTATGGGAAGAACAGGATAACCCGTGACCAAGTCCTGAAGATGGCAGCTGCTGTTGTTCTGGCCTTCATCATTTGCTGGCTTCCCTTCCATGTTCTGACCTTCCTGGATGCTCTGGCCTGGATGGGTGTCATTAATAGCTGCGAAGTTATAGCAGTCATTGACCTGGCACTTCCTTTTGCCATCCTCTTGGGATTCACCAACAGCTGCGTTAATCCGTTTCTGTATTGTTTTGTTGGAAACCGGTTCCAACAGAAGCTCCGCAGTGTGTTTAGGGTTCCAATTACTTGGCTCCAAGGGAAAAGAGAGAGTATGTCTTGCCGGAAAAGCAGTTCTCTTAGAGAAATGGAGACCTTTGTGTCTTAA
ORF Protein Sequence MKGNSTLATTSKNITSGLHFGLVNISGNNESTLNCSQKPSDKHLDAIPILYYIIFVIGFLVNIVVVTLFCCQKGPKKVSSIYIFNLAVADLLLLATLPLWATYYSYRYDWLFGPVMCKVFGSFLTLNMFASIFFITCMSVDRYQSVIYPFLSQRRNPWQASYIVPLVWCMACLSSLPTFYFRDVRTIEYLGVNACIMAFPPEKYAQWSAGIALMKNILGFIIPLIFIATCYFGIRKHLLKTNSYGKNRITRDQVLKMAAAVVLAFIICWLPFHVLTFLDALAWMGVINSCEVIAVIDLALPFAILLGFTNSCVNPFLYCFVGNRFQQKLRSVFRVPITWLQGKRESMSCRKSSSLREMETFVS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T09909-Ab Anti-AGTR2/ AT2/ ATGR2 monoclonal antibody
    Target Antigen GM-Tg-g-T09909-Ag AGTR2 VLP (virus-like particle)
    ORF Viral Vector pGMLP002255 Human AGTR2 Lentivirus plasmid
    ORF Viral Vector vGMLP002255 Human AGTR2 Lentivirus particle


    Target information

    Target ID GM-T09909
    Target Name AGTR2
    Gene ID 186, 11609, 709513, 24182, 101080516, 403835, 407157, 100053878
    Gene Symbol and Synonyms AGTR2,AT2,AT2-R,AT2R,AT2R,ATGR2,MRX88
    Uniprot Accession P50052
    Uniprot Entry Name AGTR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000180772
    Target Classification Not Available

    The protein encoded by this gene belongs to the G-protein coupled receptor 1 family, and functions as a receptor for angiotensin II. It is an intergral membrane protein that is highly expressed in fetus and in neonates, but scantily in adult tissues, except brain, adrenal medulla, and atretic ovary. This receptor has been shown to mediate programmed cell death and this apoptotic function may play an important role in developmental biology and pathophysiology. Mutations in this gene are been associated with X-linked cognitive disability. Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) and SARS-CoV-2 infection results in down-regulation of angiotensin converting enzyme-2 (ACE2) receptors, the effects of which, triggers serious inflammatory lesions in the tissues involved, primarily in the lungs. The inflammatory reaction appears to be mediated by angiotensin II derivatives, including the angiotensin AT2 receptor which has been found to be upregulated in bronchoalveolar lavage samples from Coronavirus disease 2019 (COVID19) patients. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.