Human MTHFD2/NMDMC ORF/cDNA clone-Lentivirus particle (NM_006636)

SKU: vGMLP002144
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MTHFD2/NMDMC Lentiviral expression plasmid for MTHFD2 lentivirus packaging, MTHFD2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MTHFD2/NMDMC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002144 Human MTHFD2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002144
Gene Name MTHFD2
Accession Number NM_006636
Gene ID 10797
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1053 bp
Gene Alias NMDMC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGCGACTTCTCTAATGTCTGCTTTGGCTGCCCGGCTGCTGCAGCCCGCGCACAGCTGCTCCCTTCGCCTTCGCCCTTTCCACCTCGCGGCAGTTCGAAATGAAGCTGTTGTCATTTCTGGAAGGAAACTGGCCCAGCAGATCAAGCAGGAAGTGCGGCAGGAGGTAGAAGAGTGGGTGGCCTCAGGCAACAAACGGCCACACCTGAGTGTGATCCTGGTTGGCGAGAATCCTGCAAGTCACTCCTATGTCCTCAACAAAACCAGGGCAGCTGCAGTTGTGGGAATCAACAGTGAGACAATTATGAAACCAGCTTCAATTTCAGAGGAAGAATTGTTGAATTTAATCAATAAACTGAATAATGATGATAATGTAGATGGCCTCCTTGTTCAGTTGCCTCTTCCAGAGCATATTGATGAGAGAAGGATCTGCAATGCTGTTTCTCCAGACAAGGATGTTGATGGCTTTCATGTAATTAATGTAGGACGAATGTGTTTGGATCAGTATTCCATGTTACCGGCTACTCCATGGGGTGTGTGGGAAATAATCAAGCGAACTGGCATTCCAACCCTAGGGAAGAATGTGGTTGTGGCTGGAAGGTCAAAAAACGTTGGAATGCCCATTGCAATGTTACTGCACACAGATGGGGCGCATGAACGTCCCGGAGGTGATGCCACTGTTACAATATCTCATCGATATACTCCCAAAGAGCAGTTGAAGAAACATACAATTCTTGCAGATATTGTAATATCTGCTGCAGGTATTCCAAATCTGATCACAGCAGATATGATCAAGGAAGGAGCAGCAGTCATTGATGTGGGAATAAATAGAGTTCACGATCCTGTAACTGCCAAACCCAAGTTGGTTGGAGATGTGGATTTTGAAGGAGTCAGACAAAAAGCTGGGTATATCACTCCAGTTCCTGGAGGTGTTGGCCCCATGACAGTGGCAATGCTAATGAAGAATACCATTATTGCTGCAAAAAAGGTGCTGAGGCTTGAAGAGCGAGAAGTGCTGAAGTCTAAAGAGCTTGGGGTAGCCACTAATTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA058-Ab Anti-MTDC/ MTHFD2/ NMDMC functional antibody
    Target Antigen GM-Tg-g-TA058-Ag MTHFD2 protein
    ORF Viral Vector pGMLP002144 Human MTHFD2 Lentivirus plasmid
    ORF Viral Vector vGMLP002144 Human MTHFD2 Lentivirus particle


    Target information

    Target ID GM-TA058
    Target Name MTHFD2
    Gene ID 10797, 17768, 714974, 680308, 101083836, 483107, 517539, 100053990
    Gene Symbol and Synonyms MTHFD2,NMDMC
    Uniprot Accession P13995
    Uniprot Entry Name MTDC_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000065911
    Target Classification Not Available

    This gene encodes a nuclear-encoded mitochondrial bifunctional enzyme with methylenetetrahydrofolate dehydrogenase and methenyltetrahydrofolate cyclohydrolase activities. The enzyme functions as a homodimer and is unique in its absolute requirement for magnesium and inorganic phosphate. Formation of the enzyme-magnesium complex allows binding of NAD. Alternative splicing results in two different transcripts, one protein-coding and the other not protein-coding. This gene has a pseudogene on chromosome 7. [provided by RefSeq, Mar 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.