Human CCR4/CC-CKR-4/CD194 ORF/cDNA clone-Lentivirus particle (NM_005508)

Cat. No.: vGMLP002020

Pre-made Human CCR4/CC-CKR-4/CD194 Lentiviral expression plasmid for CCR4 lentivirus packaging, CCR4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCR4/CC-CKR-4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002020 Human CCR4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002020
Gene Name CCR4
Accession Number NM_005508
Gene ID 1233
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1083 bp
Gene Alias CC-CKR-4,CD194,ChemR13,CKR4,CMKBR4,HGCN:14099,K5-5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACCCCACGGATATAGCAGACACCACCCTCGATGAAAGCATATACAGCAATTACTATCTGTATGAAAGTATCCCCAAGCCTTGCACCAAAGAAGGCATCAAGGCATTTGGGGAGCTCTTCCTGCCCCCACTGTATTCCTTGGTTTTTGTATTTGGTCTGCTTGGAAATTCTGTGGTGGTTCTGGTCCTGTTCAAATACAAGCGGCTCAGGTCCATGACTGATGTGTACCTGCTCAACCTTGCCATCTCGGATCTGCTCTTCGTGTTTTCCCTCCCTTTTTGGGGCTACTATGCAGCAGACCAGTGGGTTTTTGGGCTAGGTCTGTGCAAGATGATTTCCTGGATGTACTTGGTGGGCTTTTACAGTGGCATATTCTTTGTCATGCTCATGAGCATTGATAGATACCTGGCAATTGTGCACGCGGTGTTTTCCTTGAGGGCAAGGACCTTGACTTATGGGGTCATCACCAGTTTGGCTACATGGTCAGTGGCTGTGTTCGCCTCCCTTCCTGGCTTTCTGTTCAGCACTTGTTATACTGAGCGCAACCATACCTACTGCAAAACCAAGTACTCTCTCAACTCCACGACGTGGAAGGTTCTCAGCTCCCTGGAAATCAACATTCTCGGATTGGTGATCCCCTTAGGGATCATGCTGTTTTGCTACTCCATGATCATCAGGACCTTGCAGCATTGTAAAAATGAGAAGAAGAACAAGGCGGTGAAGATGATCTTTGCCGTGGTGGTCCTCTTCCTTGGGTTCTGGACACCTTACAACATAGTGCTCTTCCTAGAGACCCTGGTGGAGCTAGAAGTCCTTCAGGACTGCACCTTTGAAAGATACTTGGACTATGCCATCCAGGCCACAGAAACTCTGGCTTTTGTTCACTGCTGCCTTAATCCCATCATCTACTTTTTTCTGGGGGAGAAATTTCGCAAGTACATCCTACAGCTCTTCAAAACCTGCAGGGGCCTTTTTGTGCTCTGCCAATACTGTGGGCTCCTCCAAATTTACTCTGCTGACACCCCCAGCTCATCTTACACGCAGTCCACCATGGATCATGATCTCCATGATGCTCTGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-354 Pre-Made Mogamulizumab biosimilar, Whole mAb, Anti-CCR4 Antibody: Anti-CKR4/K5-5/CD194/CMKBR4/ChemR13/CC-CKR-4/HGCN:14099 therapeutic antibody
    Target Antibody GM-Tg-g-T06955-Ab Anti-CCR4/ CC-CKR-4/ CD194 monoclonal antibody
    Target Antigen GM-Tg-g-T06955-Ag CCR4 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T06955 chemokine (C-C motif) receptor 4 (CCR4) protein & antibody
    ORF Viral Vector pGMLP002020 Human CCR4 Lentivirus plasmid
    ORF Viral Vector pGMPC000641 Human CCR4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002020 Human CCR4 Lentivirus particle


    Target information

    Target ID GM-T06955
    Target Name CCR4
    Gene ID 1233, 12773, 705457, 171054, 102900629, 403541, 408019, 100056549
    Gene Symbol and Synonyms C-C CKR-4,CC-CKR-4,CCR4,CD194,CHEMR1,ChemR13,CKR4,CMKBR4,HGCN:14099,K5-5,LESTR,Sdf1r
    Uniprot Accession P51679
    Uniprot Entry Name CCR4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000183813
    Target Classification Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA)

    The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.