Human CX3CL1/ABCD-3/C3Xkine ORF/cDNA clone-Lentivirus particle (NM_002996.5)
Cat. No.: vGMLP001884
Pre-made Human CX3CL1/ABCD-3/C3Xkine Lentiviral expression plasmid for CX3CL1 lentivirus packaging, CX3CL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CX3CL1/ABCD-3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001884 | Human CX3CL1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001884 |
Gene Name | CX3CL1 |
Accession Number | NM_002996.5 |
Gene ID | 6376 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1194 bp |
Gene Alias | ABCD-3,C3Xkine,CXC3,CXC3C,fractalkine,neurotactin,NTN,NTT,SCYD1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTCCGATATCTCTGTCGTGGCTGCTCCGCTTGGCCACCTTCTGCCATCTGACTGTCCTGCTGGCTGGACAGCACCACGGTGTGACGAAATGCAACATCACGTGCAGCAAGATGACATCAAAGATACCTGTAGCTTTGCTCATCCACTATCAACAGAACCAGGCATCATGCGGCAAACGCGCAATCATCTTGGAGACGAGACAGCACAGGCTGTTCTGTGCCGACCCGAAGGAGCAATGGGTCAAGGACGCGATGCAGCATCTGGACCGCCAGGCTGCTGCCCTAACTCGAAATGGCGGCACCTTCGAGAAGCAGATCGGCGAGGTGAAGCCCAGGACCACCCCTGCCGCCGGGGGAATGGACGAGTCTGTGGTCCTGGAGCCCGAAGCCACAGGCGAAAGCAGTAGCCTGGAGCCGACTCCTTCTTCCCAGGAAGCACAGAGGGCCCTGGGGACCTCCCCAGAGCTGCCGACGGGCGTGACTGGTTCCTCAGGGACCAGGCTCCCCCCGACGCCAAAGGCTCAGGATGGAGGGCCTGTGGGCACGGAGCTTTTCCGAGTGCCTCCCGTCTCCACTGCCGCCACGTGGCAGAGTTCTGCTCCCCACCAACCTGGGCCCAGCCTCTGGGCTGAGGCAAAGACCTCTGAGGCCCCGTCCACCCAGGACCCCTCCACCCAGGCCTCCACTGCGTCCTCCCCAGCCCCAGAGGAGAATGCTCCGTCTGAAGGCCAGCGTGTGTGGGGTCAGGGACAGAGCCCCAGGCCAGAGAACTCTCTGGAGCGGGAGGAGATGGGTCCCGTGCCAGCGCACACGGATGCCTTCCAGGACTGGGGGCCTGGCAGCATGGCCCACGTCTCTGTGGTCCCTGTCTCCTCAGAAGGGACCCCCAGCAGGGAGCCAGTGGCTTCAGGCAGCTGGACCCCTAAGGCTGAGGAACCCATCCATGCCACCATGGACCCCCAGAGGCTGGGCGTCCTTATCACTCCTGTCCCTGACGCCCAGGCTGCCACCCGGAGGCAGGCGGTGGGGCTGCTGGCCTTCCTTGGCCTCCTCTTCTGCCTGGGGGTGGCCATGTTCACCTACCAGAGCCTCCAGGGCTGCCCTCGAAAGATGGCAGGAGAGATGGCGGAGGGCCTTCGCTACATCCCCCGGAGCTGTGGTAGTAATTCATATGTCCTGGTGCCCGTGTGA |
ORF Protein Sequence | MAPISLSWLLRLATFCHLTVLLAGQHHGVTKCNITCSKMTSKIPVALLIHYQQNQASCGKRAIILETRQHRLFCADPKEQWVKDAMQHLDRQAAALTRNGGTFEKQIGEVKPRTTPAAGGMDESVVLEPEATGESSSLEPTPSSQEAQRALGTSPELPTGVTGSSGTRLPPTPKAQDGGPVGTELFRVPPVSTAATWQSSAPHQPGPSLWAEAKTSEAPSTQDPSTQASTASSPAPEENAPSEGQRVWGQGQSPRPENSLEREEMGPVPAHTDAFQDWGPGSMAHVSVVPVSSEGTPSREPVASGSWTPKAEEPIHATMDPQRLGVLITPVPDAQAATRRQAVGLLAFLGLLFCLGVAMFTYQSLQGCPRKMAGEMAEGLRYIPRSCGSNSYVLVPV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-461 | Pre-Made Quetmolimab biosimilar, Whole mAb, Anti-CX3CL1 Antibody: Anti-ABCD-3/C3Xkine/CXC3/CXC3C/NTN/NTT/SCYD1/fractalkine/neurotactin therapeutic antibody |
Target Antibody | GM-Tg-g-T34405-Ab | Anti-X3CL1/ CX3CL1/ ABCD-3 monoclonal antibody |
Target Antigen | GM-Tg-g-T34405-Ag | CX3CL1 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T34405 | chemokine (C-X3-C motif) ligand 1 (CX3CL1) protein & antibody |
ORF Viral Vector | pGMLP001884 | Human CX3CL1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000860 | Human CX3CL1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001884 | Human CX3CL1 Lentivirus particle |
ORF Viral Vector | vGMLV000860 | Human CX3CL1 Lentivirus particle |
Target information
Target ID | GM-T34405 |
Target Name | CX3CL1 |
Gene ID | 6376, 20312, 574225, 89808, 101084670, 487265, 517354, 102150350 |
Gene Symbol and Synonyms | ABCD-3,C3Xkine,CX3C,CX3CL1,CXC3,CXC3C,D8Bwg0439e,FK,fractalkine,neurotactin,NTN,NTT,SCYD1 |
Uniprot Accession | P78423 |
Uniprot Entry Name | X3CL1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000006210 |
Target Classification | Tumor-associated antigen (TAA) |
This gene belongs to the CX3C subgroup of chemokines, characterized by the number of amino acids located between the conserved cysteine residues. This is the only member of the CX3C subgroup, which contains three amino acids between cysteine residues, resulting in a Cys-X-X-X-Cys configuration. The encoded protein contains an extended mucin-like stalk with a chemokine domain on top, and exists in both a membrane-anchored form where it acts as a binding molecule, or, in soluble form, as a chemotactic cytokine. The mature form of this protein can be cleaved at the cell surface, yielding different soluble forms that can interact with the G-protein coupled receptor, C-X3-C motif chemokine receptor 1 gene product. This gene plays a role in a wide range of diseases, including cancer, vasculitis, neuropathies, atherosclerosis, inflammatory diseases, and in human immunodeficiency virus infections. [provided by RefSeq, Sep 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.