Human GALR1/GALNR/GALNR1 ORF/cDNA clone-Lentivirus particle (NM_001480)

Cat. No.: vGMLP001646

Pre-made Human GALR1/GALNR/GALNR1 Lentiviral expression plasmid for GALR1 lentivirus packaging, GALR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to GAL1-R/GALR1/GALNR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001646 Human GALR1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001646
Gene Name GALR1
Accession Number NM_001480
Gene ID 2587
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1050 bp
Gene Alias GALNR,GALNR1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGCTGGCGGTCGGGAACCTCAGCGAGGGCAACGCGAGCTGGCCGGAGCCCCCCGCCCCGGAGCCCGGGCCGCTGTTCGGCATCGGCGTGGAGAACTTCGTCACGCTGGTGGTGTTCGGCCTGATCTTCGCGCTGGGTGTGCTGGGCAACAGCCTAGTGATCACCGTGCTGGCGCGCAGCAAGCCGGGCAAGCCGCGGAGCACCACCAACCTGTTCATCCTCAACCTGAGCATCGCCGACCTGGCCTACCTGCTCTTCTGCATCCCCTTCCAGGCCACCGTGTACGCGCTGCCCACCTGGGTGCTGGGCGCCTTCATCTGCAAGTTCATCCACTACTTCTTCACCGTGTCCATGCTGGTGAGCATCTTCACCCTGGCCGCGATGTCCGTGGACCGCTACGTGGCCATCGTGCACTCGCGGCGCTCCTCCTCCCTCAGGGTGTCCCGCAACGCGCTGCTGGGCGTGGGCTGCATCTGGGCGCTGTCCATTGCCATGGCCTCGCCCGTGGCCTACCACCAGGGCCTCTTCCACCCGCGCGCCAGCAACCAGACCTTCTGCTGGGAGCAGTGGCCCGACCCTCGCCACAAGAAGGCCTACGTGGTGTGCACCTTCGTCTTCGGCTACCTGCTGCCGCTCCTGCTCATCTGCTTCTGCTATGCCAAGGTCCTTAATCACTTGCATAAAAAGTTGAAGAACATGTCAAAGAAGTCTGAAGCATCCAAGAAAAAGACTGCACAGACAGTTCTGGTGGTGGTTGTGGTGTTTGGAATCTCCTGGCTGCCGCACCACATCATCCATCTCTGGGCTGAGTTTGGAGTTTTCCCGCTGACGCCGGCTTCCTTCCTCTTCAGAATCACCGCCCACTGCCTGGCGTACAGCAATTCCTCCGTGAATCCTATCATTTATGCATTTCTCTCTGAAAATTTCAGGAAGGCCTATAAACAAGTGTTCAAGTGTCACATTCGCAAAGATTCACACCTGAGTGATACTAAAGAAAGTAAAAGTCGAATAGACACCCCACCATCAACCAATTGTACTCATGTGTGA
ORF Protein Sequence MELAVGNLSEGNASWPEPPAPEPGPLFGIGVENFVTLVVFGLIFALGVLGNSLVITVLARSKPGKPRSTTNLFILNLSIADLAYLLFCIPFQATVYALPTWVLGAFICKFIHYFFTVSMLVSIFTLAAMSVDRYVAIVHSRRSSSLRVSRNALLGVGCIWALSIAMASPVAYHQGLFHPRASNQTFCWEQWPDPRHKKAYVVCTFVFGYLLPLLLICFCYAKVLNHLHKKLKNMSKKSEASKKKTAQTVLVVVVVFGISWLPHHIIHLWAEFGVFPLTPASFLFRITAHCLAYSNSSVNPIIYAFLSENFRKAYKQVFKCHIRKDSHLSDTKESKSRIDTPPSTNCTHV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T78581-Ab Anti-GALR1/ GAL1-R/ GALNR monoclonal antibody
    Target Antigen GM-Tg-g-T78581-Ag GAL1-R/GALR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001646 Human GALR1 Lentivirus plasmid
    ORF Viral Vector vGMLP001646 Human GALR1 Lentivirus particle


    Target information

    Target ID GM-T78581
    Target Name GAL1-R
    Gene ID 2587, 14427, 697450, 50577, 101100511, 106559928, 539429, 100063413
    Gene Symbol and Synonyms GALNR,GALNR1,GALR1
    Uniprot Accession P47211
    Uniprot Entry Name GALR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000166573
    Target Classification GPCR

    The neuropeptide galanin elicits a range of biological effects by interaction with specific G-protein-coupled receptors.  Galanin receptors are seven-transmembrane proteins shown to activate a variety of intracellular second-messenger pathways.  GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family.  GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.