Human CEACAM6/CD66c/CEAL ORF/cDNA clone-Lentivirus particle (NM_002483)
SKU: vGMLP001615
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CEACAM6/CD66c/CEAL Lentiviral expression plasmid for CEACAM6 lentivirus packaging, CEACAM6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CD66c/CEACAM6 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001615 | Human CEACAM6 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001615 |
Gene Name | CEACAM6 |
Accession Number | NM_002483 |
Gene ID | 4680 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1035 bp |
Gene Alias | CD66c,CEAL,NCA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGACCCCCCTCAGCCCCTCCCTGCAGATTGCATGTCCCCTGGAAGGAGGTCCTGCTCACAGCCTCACTTCTAACCTTCTGGAACCCACCCACCACTGCCAAGCTCACTATTGAATCCACGCCGTTCAATGTCGCAGAGGGGAAGGAGGTTCTTCTACTCGCCCACAACCTGCCCCAGAATCGTATTGGTTACAGCTGGTACAAAGGCGAAAGAGTGGATGGCAACAGTCTAATTGTAGGATATGTAATAGGAACTCAACAAGCTACCCCAGGGCCCGCATACAGTGGTCGAGAGACAATATACCCCAATGCATCCCTGCTGATCCAGAACGTCACCCAGAATGACACAGGATTCTATACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACCGGACAGTTCCATGTATACCCGGAGCTGCCCAAGCCCTCCATCTCCAGCAACAACTCCAACCCCGTGGAGGACAAGGATGCTGTGGCCTTCACCTGTGAACCTGAGGTTCAGAACACAACCTACCTGTGGTGGGTAAATGGTCAGAGCCTCCCGGTCAGTCCCAGGCTGCAGCTGTCCAATGGCAACATGACCCTCACTCTACTCAGCGTCAAAAGGAACGATGCAGGATCCTATGAATGTGAAATACAGAACCCAGCGAGTGCCAACCGCAGTGACCCAGTCACCCTGAATGTCCTCTATGGCCCAGATGTCCCCACCATTTCCCCCTCAAAGGCCAATTACCGTCCAGGGGAAAATCTGAACCTCTCCTGCCACGCAGCCTCTAACCCACCTGCACAGTACTCTTGGTTTATCAATGGGACGTTCCAGCAATCCACACAAGAGCTCTTTATCCCCAACATCACTGTGAATAATAGCGGATCCTATATGTGCCAAGCCCATAACTCAGCCACTGGCCTCAATAGGACCACAGTCACGATGATCACAGTCTCTGGAAGTGCTCCTGTCCTCTCAGCTGTGGCCACCGTCGGCATCACGATTGGAGTGCTGGCCAGGGTGGCTCTGATATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-578 | Pre-Made Tinurilimab biosimilar, Whole mAb, Anti-CEACAM6/CD66c Antibody: Anti-CEAL/NCA therapeutic antibody |
Biosimilar | GMP-Bios-INN-886 | Pre-Made Lemalesomab Biosimilar, Whole Mab: Anti-Nca-90 (Nonspecific Cross- Reacting Antigens 90Kda Glycoproteins, Granulocyte Cell Antigen) [human] therapeutic antibody |
Target Antibody | GM-Tg-g-T44513-Ab | Anti-CEAM6/ CD66c/ CEACAM6 monoclonal antibody |
Target Antigen | GM-Tg-g-T44513-Ag | CD66c/CEACAM6 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001615 | Human CEACAM6 Lentivirus plasmid |
ORF Viral Vector | vGMLP001615 | Human CEACAM6 Lentivirus particle |
Target information
Target ID | GM-T44513 |
Target Name | CD66c |
Gene ID | 4680, 106994775 |
Gene Symbol and Synonyms | CD66c,CEACAM6,CEAL,NCA |
Uniprot Accession | P40199 |
Uniprot Entry Name | CEAM6_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | Cancer |
Gene Ensembl | ENSG00000086548 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a protein that belongs to the carcinoembryonic antigen (CEA) family whose members are glycosyl phosphatidyl inositol (GPI) anchored cell surface glycoproteins. Members of this family play a role in cell adhesion and are widely used as tumor markers in serum immunoassay determinations of carcinoma. This gene affects the sensitivity of tumor cells to adenovirus infection. The protein encoded by this gene acts as a receptor for adherent-invasive E. coli adhesion to the surface of ileal epithelial cells in patients with Crohn's disease. This gene is clustered with genes and pseudogenes of the cell adhesion molecules subgroup of the CEA family on chromosome 19. [provided by RefSeq, Apr 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.