Human CEACAM6/CD66c/CEAL ORF/cDNA clone-Lentivirus particle (NM_002483)

SKU: vGMLP001615
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CEACAM6/CD66c/CEAL Lentiviral expression plasmid for CEACAM6 lentivirus packaging, CEACAM6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CD66c/CEACAM6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001615 Human CEACAM6 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001615
Gene Name CEACAM6
Accession Number NM_002483
Gene ID 4680
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1035 bp
Gene Alias CD66c,CEAL,NCA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGACCCCCCTCAGCCCCTCCCTGCAGATTGCATGTCCCCTGGAAGGAGGTCCTGCTCACAGCCTCACTTCTAACCTTCTGGAACCCACCCACCACTGCCAAGCTCACTATTGAATCCACGCCGTTCAATGTCGCAGAGGGGAAGGAGGTTCTTCTACTCGCCCACAACCTGCCCCAGAATCGTATTGGTTACAGCTGGTACAAAGGCGAAAGAGTGGATGGCAACAGTCTAATTGTAGGATATGTAATAGGAACTCAACAAGCTACCCCAGGGCCCGCATACAGTGGTCGAGAGACAATATACCCCAATGCATCCCTGCTGATCCAGAACGTCACCCAGAATGACACAGGATTCTATACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACCGGACAGTTCCATGTATACCCGGAGCTGCCCAAGCCCTCCATCTCCAGCAACAACTCCAACCCCGTGGAGGACAAGGATGCTGTGGCCTTCACCTGTGAACCTGAGGTTCAGAACACAACCTACCTGTGGTGGGTAAATGGTCAGAGCCTCCCGGTCAGTCCCAGGCTGCAGCTGTCCAATGGCAACATGACCCTCACTCTACTCAGCGTCAAAAGGAACGATGCAGGATCCTATGAATGTGAAATACAGAACCCAGCGAGTGCCAACCGCAGTGACCCAGTCACCCTGAATGTCCTCTATGGCCCAGATGTCCCCACCATTTCCCCCTCAAAGGCCAATTACCGTCCAGGGGAAAATCTGAACCTCTCCTGCCACGCAGCCTCTAACCCACCTGCACAGTACTCTTGGTTTATCAATGGGACGTTCCAGCAATCCACACAAGAGCTCTTTATCCCCAACATCACTGTGAATAATAGCGGATCCTATATGTGCCAAGCCCATAACTCAGCCACTGGCCTCAATAGGACCACAGTCACGATGATCACAGTCTCTGGAAGTGCTCCTGTCCTCTCAGCTGTGGCCACCGTCGGCATCACGATTGGAGTGCTGGCCAGGGTGGCTCTGATATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-578 Pre-Made Tinurilimab biosimilar, Whole mAb, Anti-CEACAM6/CD66c Antibody: Anti-CEAL/NCA therapeutic antibody
    Biosimilar GMP-Bios-INN-886 Pre-Made Lemalesomab Biosimilar, Whole Mab: Anti-Nca-90 (Nonspecific Cross- Reacting Antigens 90Kda Glycoproteins, Granulocyte Cell Antigen) [human] therapeutic antibody
    Target Antibody GM-Tg-g-T44513-Ab Anti-CEAM6/ CD66c/ CEACAM6 monoclonal antibody
    Target Antigen GM-Tg-g-T44513-Ag CD66c/CEACAM6 VLP (virus-like particle)
    ORF Viral Vector pGMLP001615 Human CEACAM6 Lentivirus plasmid
    ORF Viral Vector vGMLP001615 Human CEACAM6 Lentivirus particle


    Target information

    Target ID GM-T44513
    Target Name CD66c
    Gene ID 4680, 106994775
    Gene Symbol and Synonyms CD66c,CEACAM6,CEAL,NCA
    Uniprot Accession P40199
    Uniprot Entry Name CEAM6_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000086548
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein that belongs to the carcinoembryonic antigen (CEA) family whose members are glycosyl phosphatidyl inositol (GPI) anchored cell surface glycoproteins. Members of this family play a role in cell adhesion and are widely used as tumor markers in serum immunoassay determinations of carcinoma. This gene affects the sensitivity of tumor cells to adenovirus infection. The protein encoded by this gene acts as a receptor for adherent-invasive E. coli adhesion to the surface of ileal epithelial cells in patients with Crohn's disease. This gene is clustered with genes and pseudogenes of the cell adhesion molecules subgroup of the CEA family on chromosome 19. [provided by RefSeq, Apr 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.