Human CCR10/GPR2 ORF/cDNA clone-Lentivirus particle (NM_016602)

SKU: vGMLP001466
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCR10/GPR2 Lentiviral expression plasmid for CCR10 lentivirus packaging, CCR10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCR10/GPR2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001466 Human CCR10 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001466
Gene Name CCR10
Accession Number NM_016602
Gene ID 2826
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1089 bp
Gene Alias GPR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGACGGAGGCCACAGAGCAGGTTTCCTGGGGCCATTACTCTGGGGATGAAGAGGACGCATACTCGGCTGAGCCACTGCCGGAGCTTTGCTACAAGGCCGATGTCCAGGCCTTCAGCCGGGCCTTCCAACCCAGTGTCTCCCTGACCGTGGCTGCGCTGGGTCTGGCCGGCAATGGCCTGGTCCTGGCCACCCACCTGGCAGCCCGACGCGCAGCGCGCTCGCCCACCTCTGCCCACCTGCTCCAGCTGGCCCTGGCCGACCTCTTGCTGGCCCTGACTCTGCCCTTCGCGGCAGCAGGGGCTCTTCAGGGCTGGAGTCTGGGAAGTGCCACCTGCCGCACCATCTCTGGCCTCTACTCGGCCTCCTTCCACGCCGGCTTCCTCTTCCTGGCCTGTATCAGCGCCGACCGCTACGTGGCCATCGCGCGAGCGCTCCCAGCCGGGCCGCGGCCCTCCACTCCCGGCCGCGCACACTTGGTCTCCGTCATCGTGTGGCTGCTGTCACTGCTCCTGGCGCTGCCTGCGCTGCTCTTCAGCCAGGATGGGCAGCGGGAAGGCCAACGACGCTGTCGCCTCATCTTCCCCGAGGGCCTCACGCAGACGGTGAAGGGGGCGAGCGCCGTGGCGCAGGTGGCCCTGGGCTTCGCGCTGCCGCTGGGCGTCATGGTAGCCTGCTACGCGCTTCTGGGCCGCACGCTGCTGGCCGCCAGGGGGCCCGAGCGCCGGCGTGCGCTGCGCGTCGTGGTGGCTCTGGTGGCGGCCTTCGTGGTGCTGCAGCTGCCCTACAGCCTCGCCCTGCTGCTGGATACTGCCGATCTACTGGCTGCGCGCGAGCGGAGCTGCCCTGCCAGCAAACGCAAGGATGTCGCACTGCTGGTGACCAGCGGCTTGGCCCTCGCCCGCTGTGGCCTCAATCCCGTTCTCTACGCCTTCCTGGGCCTGCGCTTCCGCCAGGACCTGCGGAGGCTGCTACGGGGTGGGAGCTGCCCCTCAGGGCCTCAACCCCGCCGCGGCTGCCCCCGCCGGCCCCGCCTTTCTTCCTGCTCAGCTCCCACGGAGACCCACAGTCTCTCCTGGGACAACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0189-Ab Anti-CCR10/ GPR2 monoclonal antibody
    Target Antigen GM-Tg-g-MP0189-Ag CCR10 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP0189 chemokine (C-C motif) receptor 10 (CCR10) protein & antibody
    ORF Viral Vector pGMLP001466 Human CCR10 Lentivirus plasmid
    ORF Viral Vector vGMLP001466 Human CCR10 Lentivirus particle


    Target information

    Target ID GM-MP0189
    Target Name CCR10
    Gene ID 2826, 12777, 711255, 363682, 101092409, 607528, 539108, 100065946
    Gene Symbol and Synonyms C-C CKR-10,CC-CKR-10,CCR-10,CCR10,Cmkbr9,GPR2
    Uniprot Accession P46092
    Uniprot Entry Name CCR10_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000184451
    Target Classification Not Available

    Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC, based on the arrangement of the first 2 of the 4 conserved cysteine residues; the 2 cysteines are separated by a single amino acid in CXC chemokines and are adjacent in CC chemokines. CCR10 is the receptor for CCL27 (SCYA27; MIM 604833); CCR10-CCL27 interactions are involved in T cell-mediated skin inflammation (Homey et al., 2002 [PubMed 11821900]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.