Human OPRM1/LMOR/M-OR-1 ORF/cDNA clone-Lentivirus particle (NM_001008504)
SKU: vGMLP001411
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human OPRM1/LMOR/M-OR-1 Lentiviral expression plasmid for OPRM1 lentivirus packaging, OPRM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
MOP/OPRM1/LMOR products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001411 | Human OPRM1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001411 |
Gene Name | OPRM1 |
Accession Number | NM_001008504 |
Gene ID | 4988 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1179 bp |
Gene Alias | LMOR,M-OR-1,MOP,MOR,MOR1,OPRM |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACAGCAGCGCTGCCCCCACGAACGCCAGCAATTGCACTGATGCCTTGGCGTACTCAAGTTGCTCCCCAGCACCCAGCCCCGGTTCCTGGGTCAACTTGTCCCACTTAGATGGCAACCTGTCCGACCCATGCGGTCCGAACCGCACCGACCTGGGCGGGAGAGACAGCCTGTGCCCTCCGACCGGCAGTCCCTCCATGATCACGGCCATCACGATCATGGCCCTCTACTCCATCGTGTGCGTGGTGGGGCTCTTCGGAAACTTCCTGGTCATGTATGTGATTGTCAGATACACCAAGATGAAGACTGCCACCAACATCTACATTTTCAACCTTGCTCTGGCAGATGCCTTAGCCACCAGTACCCTGCCCTTCCAGAGTGTGAATTACCTAATGGGAACATGGCCATTTGGAACCATCCTTTGCAAGATAGTGATCTCCATAGATTACTATAACATGTTCACCAGCATATTCACCCTCTGCACCATGAGTGTTGATCGATACATTGCAGTCTGCCACCCTGTCAAGGCCTTAGATTTCCGTACTCCCCGAAATGCCAAAATTATCAATGTCTGCAACTGGATCCTCTCTTCAGCCATTGGTCTTCCTGTAATGTTCATGGCTACAACAAAATACAGGCAAGGTTCCATAGATTGTACACTAACATTCTCTCATCCAACCTGGTACTGGGAAAACCTGCTGAAGATCTGTGTTTTCATCTTCGCCTTCATTATGCCAGTGCTCATCATTACCGTGTGCTATGGACTGATGATCTTGCGCCTCAAGAGTGTCCGCATGCTCTCTGGCTCCAAAGAAAAGGACAGGAATCTTCGAAGGATCACCAGGATGGTGCTGGTGGTGGTGGCTGTGTTCATCGTCTGCTGGACTCCCATTCACATTTACGTCATCATTAAAGCCTTGGTTACAATCCCAGAAACTACGTTCCAGACTGTTTCTTGGCACTTCTGCATTGCTCTAGGTTACACAAACAGCTGCCTCAACCCAGTCCTTTATGCATTTCTGGATGAAAACTTCAAACGATGCTTCAGAGAGTTCTGTATCCCAACCTCTTCCAACATTGAGCAACAAAACTCCACTCGAATTCGTCAGAACACTAGAGACCACCCCTCCACGGCCAATACAGTGGATAGAACTAATCATCAGGTACGCAGTCTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T47768-Ab | Anti-OPRM/ MOP/ OPRM1 monoclonal antibody |
Target Antigen | GM-Tg-g-T47768-Ag | MOP/OPRM1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001411 | Human OPRM1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001411 | Human OPRM1 Lentivirus particle |
Target information
Target ID | GM-T47768 |
Target Name | MOP |
Gene ID | 4988, 18390, 574141, 25601, 101084452, 484041, 281958, 100060029 |
Gene Symbol and Synonyms | LMOR,M-OR-1,MOP,MOP-R,MOR,MOR-1,MOR-1O,MOR1,MORA,muOR,OPRM,OPRM1,Oprrm1 |
Uniprot Accession | P35372 |
Uniprot Entry Name | OPRM_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000112038 |
Target Classification | GPCR |
This gene encodes one of at least three opioid receptors in humans; the mu opioid receptor (MOR). The MOR is the principal target of endogenous opioid peptides and opioid analgesic agents such as beta-endorphin and enkephalins. The MOR also has an important role in dependence to other drugs of abuse, such as nicotine, cocaine, and alcohol via its modulation of the dopamine system. The NM_001008503.2:c.118A>G allele has been associated with opioid and alcohol addiction and variations in pain sensitivity but evidence for it having a causal role is conflicting. Multiple transcript variants encoding different isoforms have been found for this gene. Though the canonical MOR belongs to the superfamily of 7-transmembrane-spanning G-protein-coupled receptors some isoforms of this gene have only 6 transmembrane domains. [provided by RefSeq, Oct 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.