Human SELENOP/SELP/ SeP ORF/cDNA clone-Lentivirus particle (NM_001093726.2)
Pre-made Human SELENOP/SELP/ SeP Lentiviral expression plasmid for SELENOP lentivirus packaging, SELENOP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SELENOP/SELP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001256 | Human SELENOP Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001256 |
Gene Name | SELENOP |
Accession Number | NM_001093726.2 |
Gene ID | 6414 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1236 bp |
Gene Alias | SELP, SeP, SEPP, SEPP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGCTCTGGGCTGGACGCGGTGGCTCACGCTTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGGCGGATCACGAGGACAACCCCAGCAATGTGGAGAAGCCTGGGGCTTGCCCTGGCTCTCTGTCTCCTCCCATCGGGAGGAACAGAGAGCCAGGACCAAAGCTCCTTATGTAAGCAACCCCCAGCCTGGAGCATAAGAGATCAAGATCCAATGCTAAACTCCAATGGTTCAGTGACTGTGGTTGCTCTTCTTCAAGCCAGCTGATACCTGTGCATACTGCAGGCATCTAAATTAGAAGACCTGCGAGTAAAACTGAAGAAAGAAGGATATTCTAATATTTCTTATATTGTTGTTAATCATCAAGGAATCTCTTCTCGATTAAAATACACACATCTTAAGAATAAGGTTTCAGAGCATATTCCTGTTTATCAACAAGAAGAAAACCAAACAGATGTCTGGACTCTTTTAAATGGAAGCAAAGATGACTTCCTCATATATGATAGATGTGGCCGTCTTGTATATCATCTTGGTTTGCCTTTTTCCTTCCTAACTTTCCCATATGTAGAAGAAGCCATTAAGATTGCTTACTGTGAAAAGAAATGTGGAAACTGCTCTCTCACGACTCTCAAAGATGAAGACTTTTGTAAACGTGTATCTTTGGCTACTGTGGATAAAACAGTTGAAACTCCATCGCCTCATTACCATCATGAGCATCATCACAATCATGGACATCAGCACCTTGGCAGCAGTGAGCTTTCAGAGAATCAGCAACCAGGAGCACCAAATGCTCCTACTCATCCTGCTCCTCCAGGCCTTCATCACCACCATAAGCACAAGGGTCAGCATAGGCAGGGTCACCCAGAGAACCGAGATATGCCAGCAAGTGAAGATTTACAAGATTTACAAAAGAAGCTCTGTCGAAAGAGATGTATAAATCAATTACTCTGTAAATTGCCCACAGATTCAGAGTTGGCTCCTAGGAGCTGATGCTGCCATTGTCGACATCTGATATTTGAAAAAACAGGGTCTGCAATCACCTGACAGTGTAAAGAAAACCTCCCATCTTTATGTAGCTGACAGGGACTTCGGGCAGAGGAGAACATAACTGAATCTTGTCAGTGACGTTTGCCTCCAGCTGCCTGACAAATAAGTCAGCAGCTTATACCCACAGAAGCCAGTGCCAGTTGACGCTGAAAGAATCAGGCAAAAAAGTGAGAATGACCTTCAAACTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0464-Ab | Anti-SEPP1/ SELENOP/ SELP functional antibody |
Target Antigen | GM-Tg-g-SE0464-Ag | SELENOP protein |
ORF Viral Vector | pGMLV000211 | Human SELENOP Lentivirus plasmid |
ORF Viral Vector | pGMLP001256 | Human SELENOP Lentivirus plasmid |
ORF Viral Vector | vGMLV000211 | Human SELENOP Lentivirus particle |
ORF Viral Vector | vGMLP001256 | Human SELENOP Lentivirus particle |
Target information
Target ID | GM-SE0464 |
Target Name | SELENOP |
Gene ID | 6414, 20363, 698917, 29360, 101093246, 479346, 282066, 100052968 |
Gene Symbol and Synonyms | D15Ucla1,Se-P,SELENOP,SELP,SeP,SEPP,SEPP1 |
Uniprot Accession | P49908 |
Uniprot Entry Name | SEPP1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000250722 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a selenoprotein that is predominantly expressed in the liver and secreted into the plasma. This selenoprotein is unique in that it contains multiple selenocysteine (Sec) residues per polypeptide (10 in human), and accounts for most of the selenium in plasma. It has been implicated as an extracellular antioxidant, and in the transport of selenium to extra-hepatic tissues via apolipoprotein E receptor-2 (apoER2). Mice lacking this gene exhibit neurological dysfunction, suggesting its importance in normal brain function. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The mRNA for this selenoprotein contains two SECIS elements. The use of alternative polyadenylation sites, one located in between the two SECIS elements, results in two populations of mRNAs containing either both (predominant) or just the upstream SECIS element (PMID:27881738). Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2018]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.