Human SELENOP/SELP/ SeP ORF/cDNA clone-Lentivirus particle (NM_001093726.2)

Pre-made Human SELENOP/SELP/ SeP Lentiviral expression plasmid for SELENOP lentivirus packaging, SELENOP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SELENOP/SELP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001256 Human SELENOP Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001256
Gene Name SELENOP
Accession Number NM_001093726.2
Gene ID 6414
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1236 bp
Gene Alias SELP, SeP, SEPP, SEPP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGCTCTGGGCTGGACGCGGTGGCTCACGCTTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGGCGGATCACGAGGACAACCCCAGCAATGTGGAGAAGCCTGGGGCTTGCCCTGGCTCTCTGTCTCCTCCCATCGGGAGGAACAGAGAGCCAGGACCAAAGCTCCTTATGTAAGCAACCCCCAGCCTGGAGCATAAGAGATCAAGATCCAATGCTAAACTCCAATGGTTCAGTGACTGTGGTTGCTCTTCTTCAAGCCAGCTGATACCTGTGCATACTGCAGGCATCTAAATTAGAAGACCTGCGAGTAAAACTGAAGAAAGAAGGATATTCTAATATTTCTTATATTGTTGTTAATCATCAAGGAATCTCTTCTCGATTAAAATACACACATCTTAAGAATAAGGTTTCAGAGCATATTCCTGTTTATCAACAAGAAGAAAACCAAACAGATGTCTGGACTCTTTTAAATGGAAGCAAAGATGACTTCCTCATATATGATAGATGTGGCCGTCTTGTATATCATCTTGGTTTGCCTTTTTCCTTCCTAACTTTCCCATATGTAGAAGAAGCCATTAAGATTGCTTACTGTGAAAAGAAATGTGGAAACTGCTCTCTCACGACTCTCAAAGATGAAGACTTTTGTAAACGTGTATCTTTGGCTACTGTGGATAAAACAGTTGAAACTCCATCGCCTCATTACCATCATGAGCATCATCACAATCATGGACATCAGCACCTTGGCAGCAGTGAGCTTTCAGAGAATCAGCAACCAGGAGCACCAAATGCTCCTACTCATCCTGCTCCTCCAGGCCTTCATCACCACCATAAGCACAAGGGTCAGCATAGGCAGGGTCACCCAGAGAACCGAGATATGCCAGCAAGTGAAGATTTACAAGATTTACAAAAGAAGCTCTGTCGAAAGAGATGTATAAATCAATTACTCTGTAAATTGCCCACAGATTCAGAGTTGGCTCCTAGGAGCTGATGCTGCCATTGTCGACATCTGATATTTGAAAAAACAGGGTCTGCAATCACCTGACAGTGTAAAGAAAACCTCCCATCTTTATGTAGCTGACAGGGACTTCGGGCAGAGGAGAACATAACTGAATCTTGTCAGTGACGTTTGCCTCCAGCTGCCTGACAAATAAGTCAGCAGCTTATACCCACAGAAGCCAGTGCCAGTTGACGCTGAAAGAATCAGGCAAAAAAGTGAGAATGACCTTCAAACTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0464-Ab Anti-SEPP1/ SELENOP/ SELP functional antibody
    Target Antigen GM-Tg-g-SE0464-Ag SELENOP protein
    ORF Viral Vector pGMLV000211 Human SELENOP Lentivirus plasmid
    ORF Viral Vector pGMLP001256 Human SELENOP Lentivirus plasmid
    ORF Viral Vector vGMLV000211 Human SELENOP Lentivirus particle
    ORF Viral Vector vGMLP001256 Human SELENOP Lentivirus particle


    Target information

    Target ID GM-SE0464
    Target Name SELENOP
    Gene ID 6414, 20363, 698917, 29360, 101093246, 479346, 282066, 100052968
    Gene Symbol and Synonyms D15Ucla1,Se-P,SELENOP,SELP,SeP,SEPP,SEPP1
    Uniprot Accession P49908
    Uniprot Entry Name SEPP1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000250722
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a selenoprotein that is predominantly expressed in the liver and secreted into the plasma. This selenoprotein is unique in that it contains multiple selenocysteine (Sec) residues per polypeptide (10 in human), and accounts for most of the selenium in plasma. It has been implicated as an extracellular antioxidant, and in the transport of selenium to extra-hepatic tissues via apolipoprotein E receptor-2 (apoER2). Mice lacking this gene exhibit neurological dysfunction, suggesting its importance in normal brain function. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The mRNA for this selenoprotein contains two SECIS elements. The use of alternative polyadenylation sites, one located in between the two SECIS elements, results in two populations of mRNAs containing either both (predominant) or just the upstream SECIS element (PMID:27881738). Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2018]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.