Human SCG5/7B2/P7B2 ORF/cDNA clone-Lentivirus particle (NM_003020.4)
Cat. No.: vGMLP001208
Pre-made Human SCG5/7B2/P7B2 Lentiviral expression plasmid for SCG5 lentivirus packaging, SCG5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
SCG5/7B2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001208 | Human SCG5 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001208 |
Gene Name | SCG5 |
Accession Number | NM_003020.4 |
Gene ID | 6447 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 636 bp |
Gene Alias | 7B2,P7B2,SGNE1,SgV |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTCTCCAGGATGGTCTCTACCATGCTATCTGGCCTACTGTTTTGGCTGGCATCTGGATGGACTCCAGCATTTGCTTACAGCCCCCGGACCCCTGACCGGGTCTCAGAAGCAGATATCCAGAGGCTGCTTCATGGTGTTATGGAGCAATTGGGCATTGCCAGGCCCCGAGTGGAATATCCAGCTCACCAGGCCATGAATCTTGTGGGCCCCCAGAGCATTGAAGGTGGAGCTCATGAAGGACTTCAGCATTTGGGTCCTTTTGGCAACATCCCCAACATCGTGGCAGAGTTGACTGGAGACAACATTCCTAAGGACTTTAGTGAGGATCAGGGGTACCCAGACCCTCCAAATCCCTGTCCTGTTGGAAAAACAGATGATGGATGTCTAGAAAACACCCCTGACACTGCAGAGTTCAGTCGAGAGTTCCAGTTGCACCAGCATCTCTTTGATCCGGAACATGACTATCCAGGCTTGGGCAAGTGGAACAAGAAACTCCTTTACGAGAAGATGAAGGGAGGAGAGAGACGAAAGCGGAGGAGTGTCAATCCATATCTACAAGGACAGAGACTGGATAATGTTGTTGCAAAGAAGTCTGTCCCCCATTTTTCAGATGAGGATAAGGATCCAGAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1262-Ab | Anti-7B2/ SCG5/ P7B2 functional antibody |
Target Antigen | GM-Tg-g-SE1262-Ag | SCG5 protein |
ORF Viral Vector | pGMLP001208 | Human SCG5 Lentivirus plasmid |
ORF Viral Vector | vGMLP001208 | Human SCG5 Lentivirus particle |
Target information
Target ID | GM-SE1262 |
Target Name | SCG5 |
Gene ID | 6447, 20394, 694088, 25719, 478249, 508224, 100071769 |
Gene Symbol and Synonyms | 7B2,P7B2,SCG5,Sgne-1,SGNE1,SgV |
Uniprot Accession | P05408 |
Uniprot Entry Name | 7B2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000166922 |
Target Classification | Not Available |
This gene encodes a secreted chaperone protein that prevents the aggregation of other secreted proteins, including proteins that are associated with neurodegenerative and metabolic disease. The encoded protein may be best known for its role in the trafficking and activation of prohormone convertase PC2 (encoded by Gene ID: 5126). Phosphorylation of the encoded protein has been shown to have an inhibitory effect on its chaperone function. This gene also produces a ARHGAP11A-SCG5 readthrough transcript and ARHGAP11A-SCG5 protein. [provided by RefSeq, Feb 2019]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.