Human CCL8/HC14/MCP-2 ORF/cDNA clone-Lentivirus particle (BC126242)

SKU: vGMLP000800
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCL8/HC14/MCP-2 Lentiviral expression plasmid for CCL8 lentivirus packaging, CCL8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.


Target products collection

Go to CCL8/HC14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000800 Human CCL8 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000800
Gene Name CCL8
Accession Number BC126242
Gene ID 6355
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 300 bp
Gene Alias HC14,MCP-2,MCP2,SCYA10
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGGTTTCTGCAGCGCTTCTGTGCCTGCTGCTCATGGCAGCCACTTTCAGCCCTCAGGGACTTGCTCAGCCAGATTCAGTTTCCATTCCAATCACCTGCTGCTTTAACGTGATCAATAGGAAAATTCCTATCCAGAGGCTGGAGAGCTACACAAGAATCACCAACATCCAATGTCCCAAGGAAGCTGTGATCTTCAAGACCCAACGGGGCAAGGAGGTCTGTGCTGACCCCAAGGAGAGATGGGTCAGGGATTCCATGAAGCATCTGGACCAAATATTTCAAAATCTGAAGCCATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0751-Ab Anti-CCL8/ HC14/ MCP-2 functional antibody
    Target Antigen GM-Tg-g-SE0751-Ag CCL8 protein
    Cytokine cks-Tg-g-GM-SE0751 chemokine (C-C motif) ligand 8 (CCL8) protein & antibody
    ORF Viral Vector pGMLP000800 Human CCL8 Lentivirus plasmid
    ORF Viral Vector pGMPC000252 Human CCL8 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000800 Human CCL8 Lentivirus particle


    Target information

    Target ID GM-SE0751
    Target Name CCL8
    Gene ID 6355, 574179, 101097189
    Gene Symbol and Synonyms CCL8,HC14,MCP-2,MCP2,SCYA10,SCYA8
    Uniprot Accession P80075
    Uniprot Entry Name CCL8_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000108700
    Target Classification Not Available

    This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils. By recruiting leukocytes to sites of inflammation this cytokine may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.