Human WISP3/CCN6/LIBC ORF/cDNA clone-Lentivirus particle (NM_198239)

Cat. No.: vGMLP000776

Pre-made Human WISP3/CCN6/LIBC Lentiviral expression plasmid for WISP3 lentivirus packaging, WISP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCN6/WISP3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000776 Human WISP3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000776
Gene Name WISP3
Accession Number NM_198239
Gene ID 8838
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1119 bp
Gene Alias CCN6,LIBC,PPAC,PPD,WISP-3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGGGGCTCCTCTTCTCCACTCTTCTGCTTGCTGGCCTGGCACAGTTCTGCTGCAGGGTACAGGGCACTGGACCATTAGATACAACACCTGAAGGAAGGCCTGGAGAAGTGTCAGATGCACCTCAGCGTAAACAGTTTTGTCACTGGCCCTGCAAATGCCCTCAGCAGAAGCCCCGTTGCCCTCCTGGAGTGAGCCTGGTGAGAGATGGCTGTGGATGCTGTAAAATCTGTGCCAAGCAACCAGGGGAAATCTGCAATGAAGCTGACCTCTGTGACCCACACAAAGGGCTGTATTGTGACTACTCAGTAGACAGGCCTAGGTACGAGACTGGAGTGTGTGCATACCTTGTAGCTGTTGGGTGCGAGTTCAACCAGGTACATTATCATAATGGCCAAGTGTTTCAGCCCAACCCCTTGTTCAGCTGCCTCTGTGTGAGTGGGGCCATTGGATGCACACCTCTGTTCATACCAAAGCTGGCTGGCAGTCACTGCTCTGGAGCTAAAGGTGGAAAGAAGTCTGATCAGTCAAACTGTAGCCTGGAACCATTACTACAGCAGCTTTCAACAAGCTACAAAACAATGCCAGCTTATAGAAATCTCCCACTTATTTGGAAAAAAAAATGTCTTGTGCAAGCAACAAAATGGACTCCCTGCTCCAGAACATGTGGGATGGGAATATCTAACAGGGTGACCAATGAAAACAGCAACTGTGAAATGAGAAAAGAGAAAAGACTGTGTTACATTCAGCCTTGCGACAGCAATATATTAAAGACAATAAAGATTCCCAAAGGAAAAACATGCCAACCTACTTTCCAACTCTCCAAAGCTGAAAAATTTGTCTTTTCTGGATGCTCAAGTACTCAGAGTTACAAACCCACTTTTTGTGGAATATGCTTGGATAAGAGATGCTGTATCCCTAATAAGTCTAAAATGATTACTATTCAATTTGATTGCCCAAATGAGGGGTCATTTAAATGGAAGATGCTGTGGATTACATCTTGTGTGTGTCAGAGAAACTGCAGAGAACCTGGAGATATATTTTCTGAGCTCAAGATTCTGTAA
ORF Protein Sequence MQGLLFSTLLLAGLAQFCCRVQGTGPLDTTPEGRPGEVSDAPQRKQFCHWPCKCPQQKPRCPPGVSLVRDGCGCCKICAKQPGEICNEADLCDPHKGLYCDYSVDRPRYETGVCAYLVAVGCEFNQVHYHNGQVFQPNPLFSCLCVSGAIGCTPLFIPKLAGSHCSGAKGGKKSDQSNCSLEPLLQQLSTSYKTMPAYRNLPLIWKKKCLVQATKWTPCSRTCGMGISNRVTNENSNCEMRKEKRLCYIQPCDSNILKTIKIPKGKTCQPTFQLSKAEKFVFSGCSSTQSYKPTFCGICLDKRCCIPNKSKMITIQFDCPNEGSFKWKMLWITSCVCQRNCREPGDIFSELKIL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T23655-Ab Anti-CCN6/ LIBC/ PPAC functional antibody
    Target Antigen GM-Tg-g-T23655-Ag CCN6 protein
    Cytokine cks-Tg-g-GM-T23655 WNT1 inducible signaling pathway protein 3 (WISP3) protein & antibody
    ORF Viral Vector pGMLP000776 Human WISP3 Lentivirus plasmid
    ORF Viral Vector vGMLP000776 Human WISP3 Lentivirus particle


    Target information

    Target ID GM-T23655
    Target Name CCN6
    Gene ID 8838, 327743, 695430, 499461, 101086230, 100686448, 100849041, 100072430
    Gene Symbol and Synonyms CCN6,Gm735,LIBC,PPAC,PPD,PPRD,RGD1564120,WISP-3,WISP3
    Uniprot Accession O95389
    Uniprot Entry Name CCN6_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000112761
    Target Classification Not Available

    This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.