Human WISP3/CCN6/LIBC ORF/cDNA clone-Lentivirus particle (NM_198239)
Cat. No.: vGMLP000776
Pre-made Human WISP3/CCN6/LIBC Lentiviral expression plasmid for WISP3 lentivirus packaging, WISP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CCN6/WISP3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000776 | Human WISP3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000776 |
Gene Name | WISP3 |
Accession Number | NM_198239 |
Gene ID | 8838 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1119 bp |
Gene Alias | CCN6,LIBC,PPAC,PPD,WISP-3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCAGGGGCTCCTCTTCTCCACTCTTCTGCTTGCTGGCCTGGCACAGTTCTGCTGCAGGGTACAGGGCACTGGACCATTAGATACAACACCTGAAGGAAGGCCTGGAGAAGTGTCAGATGCACCTCAGCGTAAACAGTTTTGTCACTGGCCCTGCAAATGCCCTCAGCAGAAGCCCCGTTGCCCTCCTGGAGTGAGCCTGGTGAGAGATGGCTGTGGATGCTGTAAAATCTGTGCCAAGCAACCAGGGGAAATCTGCAATGAAGCTGACCTCTGTGACCCACACAAAGGGCTGTATTGTGACTACTCAGTAGACAGGCCTAGGTACGAGACTGGAGTGTGTGCATACCTTGTAGCTGTTGGGTGCGAGTTCAACCAGGTACATTATCATAATGGCCAAGTGTTTCAGCCCAACCCCTTGTTCAGCTGCCTCTGTGTGAGTGGGGCCATTGGATGCACACCTCTGTTCATACCAAAGCTGGCTGGCAGTCACTGCTCTGGAGCTAAAGGTGGAAAGAAGTCTGATCAGTCAAACTGTAGCCTGGAACCATTACTACAGCAGCTTTCAACAAGCTACAAAACAATGCCAGCTTATAGAAATCTCCCACTTATTTGGAAAAAAAAATGTCTTGTGCAAGCAACAAAATGGACTCCCTGCTCCAGAACATGTGGGATGGGAATATCTAACAGGGTGACCAATGAAAACAGCAACTGTGAAATGAGAAAAGAGAAAAGACTGTGTTACATTCAGCCTTGCGACAGCAATATATTAAAGACAATAAAGATTCCCAAAGGAAAAACATGCCAACCTACTTTCCAACTCTCCAAAGCTGAAAAATTTGTCTTTTCTGGATGCTCAAGTACTCAGAGTTACAAACCCACTTTTTGTGGAATATGCTTGGATAAGAGATGCTGTATCCCTAATAAGTCTAAAATGATTACTATTCAATTTGATTGCCCAAATGAGGGGTCATTTAAATGGAAGATGCTGTGGATTACATCTTGTGTGTGTCAGAGAAACTGCAGAGAACCTGGAGATATATTTTCTGAGCTCAAGATTCTGTAA |
ORF Protein Sequence | MQGLLFSTLLLAGLAQFCCRVQGTGPLDTTPEGRPGEVSDAPQRKQFCHWPCKCPQQKPRCPPGVSLVRDGCGCCKICAKQPGEICNEADLCDPHKGLYCDYSVDRPRYETGVCAYLVAVGCEFNQVHYHNGQVFQPNPLFSCLCVSGAIGCTPLFIPKLAGSHCSGAKGGKKSDQSNCSLEPLLQQLSTSYKTMPAYRNLPLIWKKKCLVQATKWTPCSRTCGMGISNRVTNENSNCEMRKEKRLCYIQPCDSNILKTIKIPKGKTCQPTFQLSKAEKFVFSGCSSTQSYKPTFCGICLDKRCCIPNKSKMITIQFDCPNEGSFKWKMLWITSCVCQRNCREPGDIFSELKIL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T23655-Ab | Anti-CCN6/ LIBC/ PPAC functional antibody |
Target Antigen | GM-Tg-g-T23655-Ag | CCN6 protein |
Cytokine | cks-Tg-g-GM-T23655 | WNT1 inducible signaling pathway protein 3 (WISP3) protein & antibody |
ORF Viral Vector | pGMLP000776 | Human WISP3 Lentivirus plasmid |
ORF Viral Vector | vGMLP000776 | Human WISP3 Lentivirus particle |
Target information
Target ID | GM-T23655 |
Target Name | CCN6 |
Gene ID | 8838, 327743, 695430, 499461, 101086230, 100686448, 100849041, 100072430 |
Gene Symbol and Synonyms | CCN6,Gm735,LIBC,PPAC,PPD,PPRD,RGD1564120,WISP-3,WISP3 |
Uniprot Accession | O95389 |
Uniprot Entry Name | CCN6_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000112761 |
Target Classification | Not Available |
This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.