Human M6PR/CD-M6PR/CD-MPR ORF/cDNA clone-Lentivirus particle (NM_002355)

Cat. No.: vGMLP000738

Pre-made Human M6PR/CD-M6PR/CD-MPR Lentiviral expression plasmid for M6PR lentivirus packaging, M6PR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to M6PR/CD-M6PR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000738 Human M6PR Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000738
Gene Name M6PR
Accession Number NM_002355
Gene ID 4074
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 834 bp
Gene Alias CD-M6PR,CD-MPR,MPR 46,MPR-46,MPR46,SMPR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTCCCTTTCTACAGCTGCTGGAGGACTGGACTGCTACTACTACTCCTGGCTGTGGCAGTGAGAGAATCCTGGCAGACAGAAGAAAAAACTTGCGACTTGGTAGGAGAAAAGGGTAAAGAGTCAGAGAAAGAGTTGGCTCTAGTGAAGAGGCTGAAACCACTGTTTAATAAAAGCTTTGAGAGCACTGTGGGCCAGGGTTCAGACACATACATCTACATCTTCAGGGTGTGCCGGGAAGCTGGCAACCACACTTCTGGGGCAGGCCTGGTGCAAATCAACAAAAGTAATGGGAAGGAGACAGTGGTAGGGAGACTCAACGAGACTCACATCTTCAACGGAAGTAATTGGATCATGCTGATCTATAAAGGGGGTGATGAATATGACAACCACTGTGGCAAGGAGCAGCGTCGTGCAGTGGTGATGATCTCCTGCAATCGACACACCCTAGCGGACAATTTTAACCCTGTGTCTGAGGAGCGTGGCAAAGTCCAAGATTGTTTCTACCTCTTTGAGATGGATAGCAGCCTGGCCTGTTCACCAGAGATCTCCCACCTCAGTGTGGGTTCCATCTTACTTGTCACGTTTGCATCACTGGTTGCTGTTTATGTTGTTGGGGGGTTCCTATACCAGCGACTGGTAGTGGGAGCCAAAGGAATGGAGCAGTTTCCCCACTTAGCCTTCTGGCAGGATCTTGGCAACCTGGTAGCAGATGGCTGTGACTTTGTCTGCCGTTCTAAACCTCGAAATGTGCCTGCAGCATATCGTGGTGTGGGGGATGACCAGCTGGGGGAGGAGTCAGAAGAAAGGGATGACCATTTATTACCAATGTAG
ORF Protein Sequence MFPFYSCWRTGLLLLLLAVAVRESWQTEEKTCDLVGEKGKESEKELALVKRLKPLFNKSFESTVGQGSDTYIYIFRVCREAGNHTSGAGLVQINKSNGKETVVGRLNETHIFNGSNWIMLIYKGGDEYDNHCGKEQRRAVVMISCNRHTLADNFNPVSEERGKVQDCFYLFEMDSSLACSPEISHLSVGSILLVTFASLVAVYVVGGFLYQRLVVGAKGMEQFPHLAFWQDLGNLVADGCDFVCRSKPRNVPAAYRGVGDDQLGEESEERDDHLLPM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T97174-Ab Anti-MPRD/ M6PR/ CD-M6PR monoclonal antibody
    Target Antigen GM-Tg-g-T97174-Ag M6PR VLP (virus-like particle)
    ORF Viral Vector pGMLP000738 Human M6PR Lentivirus plasmid
    ORF Viral Vector vGMLP000738 Human M6PR Lentivirus particle


    Target information

    Target ID GM-T97174
    Target Name M6PR
    Gene ID 4074, 17113, 716696, 312689, 101098389, 477700, 281291, 100061559
    Gene Symbol and Synonyms CD-M6PR,CD-MPR,CDMPR,M6PR,MPR 46,MPR-46,MPR46,SMPR
    Uniprot Accession P20645
    Uniprot Entry Name MPRD_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000003056
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the P-type lectin family. P-type lectins play a critical role in lysosome function through the specific transport of mannose-6-phosphate-containing acid hydrolases from the Golgi complex to lysosomes. The encoded protein functions as a homodimer and requires divalent cations for ligand binding. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, May 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.