Human FGFRL1/FGFR5/FHFR ORF/cDNA clone-Lentivirus particle (NM_021923)

Cat. No.: vGMLP000660

Pre-made Human FGFRL1/FGFR5/FHFR Lentiviral expression plasmid for FGFRL1 lentivirus packaging, FGFRL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to FGFRL1/FGFR5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000660 Human FGFRL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000660
Gene Name FGFRL1
Accession Number NM_021923
Gene ID 53834
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1515 bp
Gene Alias FGFR5,FHFR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACGCCGAGCCCCCTGTTGCTGCTCCTGCTGCCGCCGCTGCTGCTGGGGGCCTTCCCGCCGGCCGCCGCCGCCCGAGGCCCCCCAAAGATGGCGGACAAGGTGGTCCCACGGCAGGTGGCCCGGCTGGGCCGCACTGTGCGGCTGCAGTGCCCAGTGGAGGGGGACCCGCCGCCGCTGACCATGTGGACCAAGGATGGCCGCACCATCCACAGCGGCTGGAGCCGCTTCCGCGTGCTGCCGCAGGGGCTGAAGGTGAAGCAGGTGGAGCGGGAGGATGCCGGCGTGTACGTGTGCAAGGCCACCAACGGCTTCGGCAGCCTGAGCGTCAACTACACCCTCGTCGTGCTGGATGACATTAGCCCAGGGAAGGAGAGCCTGGGGCCCGACAGCTCCTCTGGGGGTCAAGAGGACCCCGCCAGCCAGCAGTGGGCACGACCGCGCTTCACACAGCCCTCCAAGATGAGGCGCCGGGTGATCGCACGGCCCGTGGGTAGCTCCGTGCGGCTCAAGTGCGTGGCCAGCGGGCACCCTCGGCCCGACATCACGTGGATGAAGGACGACCAGGCCTTGACGCGCCCAGAGGCCGCTGAGCCCAGGAAGAAGAAGTGGACACTGAGCCTGAAGAACCTGCGGCCGGAGGACAGCGGCAAATACACCTGCCGCGTGTCGAACCGCGCGGGCGCCATCAACGCCACCTACAAGGTGGATGTGATCCAGCGGACCCGTTCCAAGCCCGTGCTCACAGGCACGCACCCCGTGAACACGACGGTGGACTTCGGGGGGACCACGTCCTTCCAGTGCAAGGTGCGCAGCGACGTGAAGCCGGTGATCCAGTGGCTGAAGCGCGTGGAGTACGGCGCCGAGGGCCGCCACAACTCCACCATCGATGTGGGCGGCCAGAAGTTTGTGGTGCTGCCCACGGGTGACGTGTGGTCGCGGCCCGACGGCTCCTACCTCAATAAGCTGCTCATCACCCGTGCCCGCCAGGACGATGCGGGCATGTACATCTGCCTTGGCGCCAACACCATGGGCTACAGCTTCCGCAGCGCCTTCCTCACCGTGCTGCCAGACCCAAAACCGCCAGGGCCACCTGTGGCCTCCTCGTCCTCGGCCACTAGCCTGCCGTGGCCCGTGGTCATCGGCATCCCAGCCGGCGCTGTCTTCATCCTGGGCACCCTGCTCCTGTGGCTTTGCCAGGCCCAGAAGAAGCCGTGCACCCCCGCGCCTGCCCCTCCCCTGCCTGGGCACCGCCCGCCGGGGACGGCCCGCGACCGCAGCGGAGACAAGGACCTTCCCTCGTTGGCCGCCCTCAGCGCTGGCCCTGGTGTGGGGCTGTGTGAGGAGCATGGGTCTCCGGCAGCCCCCCAGCACTTACTGGGCCCAGGCCCAGTTGCTGGCCCTAAGTTGTACCCCAAACTCTACACAGACATCCACACACACACACACACACACTCTCACACACACTCACACGTGGAGGGCAAGGTCCACCAGCACATCCACTATCAGTGCTAG
ORF Protein Sequence MTPSPLLLLLLPPLLLGAFPPAAAARGPPKMADKVVPRQVARLGRTVRLQCPVEGDPPPLTMWTKDGRTIHSGWSRFRVLPQGLKVKQVEREDAGVYVCKATNGFGSLSVNYTLVVLDDISPGKESLGPDSSSGGQEDPASQQWARPRFTQPSKMRRRVIARPVGSSVRLKCVASGHPRPDITWMKDDQALTRPEAAEPRKKKWTLSLKNLRPEDSGKYTCRVSNRAGAINATYKVDVIQRTRSKPVLTGTHPVNTTVDFGGTTSFQCKVRSDVKPVIQWLKRVEYGAEGRHNSTIDVGGQKFVVLPTGDVWSRPDGSYLNKLLITRARQDDAGMYICLGANTMGYSFRSAFLTVLPDPKPPGPPVASSSSATSLPWPVVIGIPAGAVFILGTLLLWLCQAQKKPCTPAPAPPLPGHRPPGTARDRSGDKDLPSLAALSAGPGVGLCEEHGSPAAPQHLLGPGPVAGPKLYPKLYTDIHTHTHTHSHTHSHVEGKVHQHIHYQC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0442-Ab Anti-FGRL1/ FGFRL1/ FGFR5 monoclonal antibody
    Target Antigen GM-Tg-g-MP0442-Ag FGFRL1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP0442 fibroblast growth factor receptor-like 1 (FGFRL1) protein & antibody
    ORF Viral Vector pGMLP000660 Human FGFRL1 Lentivirus plasmid
    ORF Viral Vector pGMLP005254 Human FGFRL1 Lentivirus plasmid
    ORF Viral Vector vGMLP000660 Human FGFRL1 Lentivirus particle
    ORF Viral Vector vGMLP005254 Human FGFRL1 Lentivirus particle


    Target information

    Target ID GM-MP0442
    Target Name FGFRL1
    Gene ID 53834, 116701, 702927, 360903, 101095654, 102151155, 532327, 100630904
    Gene Symbol and Synonyms FGFR-5,FGFR5,FGFR5beta,FGFR5gamma,FGFRL1,FHFR
    Uniprot Accession Q8N441
    Uniprot Entry Name FGRL1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000127418
    Target Classification Not Available

    The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.