Human ACTG1/ACT/ACTG ORF/cDNA clone-Lentivirus particle (NM_001614)

Cat. No.: vGMLP000447

Pre-made Human ACTG1/ACT/ACTG Lentiviral expression plasmid for ACTG1 lentivirus packaging, ACTG1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ACTG/ACTG1/ACT products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000447 Human ACTG1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000447
Gene Name ACTG1
Accession Number NM_001614
Gene ID 71
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1128 bp
Gene Alias ACT,ACTG,DFNA20,DFNA26,HEL-176
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAAGCTGGTTTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCCAGACACCAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGCAAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAGCACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAA
ORF Protein Sequence MEEEIAALVIDNGSGMCKAGFAGDDAPRAVFPSIVGRPRHQGVMVGMGQKDSYVGDEAQSKRGILTLKYPIEHGIVTNWDDMEKIWHHTFYNELRVAPEEHPVLLTEAPLNPKANREKMTQIMFETFNTPAMYVAIQAVLSLYASGRTTGIVMDSGDGVTHTVPIYEGYALPHAILRLDLAGRDLTDYLMKILTERGYSFTTTAEREIVRDIKEKLCYVALDFEQEMATAASSSSLEKSYELPDGQVITIGNERFRCPEALFQPSFLGMESCGIHETTFNSIMKCDVDIRKDLYANTVLSGGTTMYPGIADRMQKEITALAPSTMKIKIIAPPERKYSVWIGGSILASLSTFQQMWISKQEYDESGPSIVHRKCF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T27457-Ab Anti-ACTG monoclonal antibody
    Target Antigen GM-Tg-g-T27457-Ag ACTG/ACTG1 protein
    ORF Viral Vector pGMLP000447 Human ACTG1 Lentivirus plasmid
    ORF Viral Vector vGMLP000447 Human ACTG1 Lentivirus particle


    Target information

    Target ID GM-T27457
    Target Name ACTG
    Gene ID 71, 11465, 713687, 287876, 100144392, 475923, 404122, 100050139
    Gene Symbol and Synonyms ACT,ACTA1,ACTB,ACTG,ACTG1,Actl,DFNA20,DFNA26,E51,HEL-176
    Uniprot Accession P63261
    Uniprot Entry Name ACTG_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000184009
    Target Classification Not Available

    Actins are highly conserved proteins that are involved in various types of cell motility and in maintenance of the cytoskeleton. Three main groups of actin isoforms have been identified in vertebrate animals: alpha, beta, and gamma. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. Actin gamma 1, encoded by this gene, is a cytoplasmic actin found in all cell types. Mutations in this gene are associated with DFNA20/26, a subtype of autosomal dominant non-syndromic sensorineural progressive hearing loss and also with Baraitser-Winter syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.