Human SDF2 ORF/cDNA clone-Lentivirus particle (NM_006923.3)

Cat. No.: vGMLP000385
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SDF2/ Lentiviral expression plasmid for SDF2 lentivirus packaging, SDF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SDF2/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000385 Human SDF2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000385
Gene Name SDF2
Accession Number NM_006923.3
Gene ID 6388
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 636 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGTAGTACCTCTGCTGTTGTTGGGGGGTTTGTGGAGCGCTGTGGGAGCGTCCAGCCTGGGTGTCGTTACTTGCGGCTCCGTGGTGAAGCTACTCAATACGCGCCACAACGTCCGACTGCACTCACACGACGTGCGCTATGGGTCAGGTAGTGGGCAGCAGTCAGTGACAGGTGTAACCTCTGTGGATGACAGCAACAGTTACTGGAGGATACGGGGGAAGAGTGCCACAGTGTGTGAGAGGGGAACCCCCATCAAGTGTGGCCAGCCCATCCGGCTGACACATGTCAACACTGGCCGAAACCTCCATAGTCACCACTTCACTTCACCTCTTTCTGGAAACCAGGAAGTGAGTGCTTTTGGTGAGGAAGGTGAAGGTGATTATCTGGATGACTGGACAGTGCTCTGTAATGGACCCTACTGGGTGAGAGATGGTGAGGTGCGGTTCAAACACTCTTCCACTGAGGTACTGCTGTCTGTCACAGGAGAACAATATGGTCGACCTATCAGTGGGCAAAAAGAGGTGCATGGCATGGCCCAGCCAAGTCAGAACAACTACTGGAAAGCCATGGAAGGCATCTTCATGAAGCCCAGTGAGTTGTTGAAGGCAGAAGCCCACCATGCAGAGCTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1498-Ab Anti-SDF2 functional antibody
    Target Antigen GM-Tg-g-SE1498-Ag SDF2 protein
    ORF Viral Vector pGMLP000385 Human SDF2 Lentivirus plasmid
    ORF Viral Vector vGMLP000385 Human SDF2 Lentivirus particle


    Target information

    Target ID GM-SE1498
    Target Name SDF2
    Gene ID 6388, 20316, 716189, 287470, 101098096, 480626, 508463, 100059307
    Gene Symbol and Synonyms SDF2
    Uniprot Accession Q99470
    Uniprot Entry Name SDF2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000132581
    Target Classification Not Available

    The protein encoded by this gene is believed to be a secretory protein. It has regions of similarity to hydrophilic segments of yeast mannosyltransferases. Its expression is ubiquitous and the gene appears to be relatively conserved among mammals. Alternate splicing results in both coding and non-coding variants. A pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Dec 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.