Human SDF2 ORF/cDNA clone-Lentivirus particle (NM_006923.3)
Cat. No.: vGMLP000385
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SDF2/ Lentiviral expression plasmid for SDF2 lentivirus packaging, SDF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
SDF2/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000385 | Human SDF2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000385 |
Gene Name | SDF2 |
Accession Number | NM_006923.3 |
Gene ID | 6388 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 636 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTGTAGTACCTCTGCTGTTGTTGGGGGGTTTGTGGAGCGCTGTGGGAGCGTCCAGCCTGGGTGTCGTTACTTGCGGCTCCGTGGTGAAGCTACTCAATACGCGCCACAACGTCCGACTGCACTCACACGACGTGCGCTATGGGTCAGGTAGTGGGCAGCAGTCAGTGACAGGTGTAACCTCTGTGGATGACAGCAACAGTTACTGGAGGATACGGGGGAAGAGTGCCACAGTGTGTGAGAGGGGAACCCCCATCAAGTGTGGCCAGCCCATCCGGCTGACACATGTCAACACTGGCCGAAACCTCCATAGTCACCACTTCACTTCACCTCTTTCTGGAAACCAGGAAGTGAGTGCTTTTGGTGAGGAAGGTGAAGGTGATTATCTGGATGACTGGACAGTGCTCTGTAATGGACCCTACTGGGTGAGAGATGGTGAGGTGCGGTTCAAACACTCTTCCACTGAGGTACTGCTGTCTGTCACAGGAGAACAATATGGTCGACCTATCAGTGGGCAAAAAGAGGTGCATGGCATGGCCCAGCCAAGTCAGAACAACTACTGGAAAGCCATGGAAGGCATCTTCATGAAGCCCAGTGAGTTGTTGAAGGCAGAAGCCCACCATGCAGAGCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1498-Ab | Anti-SDF2 functional antibody |
Target Antigen | GM-Tg-g-SE1498-Ag | SDF2 protein |
ORF Viral Vector | pGMLP000385 | Human SDF2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000385 | Human SDF2 Lentivirus particle |
Target information
Target ID | GM-SE1498 |
Target Name | SDF2 |
Gene ID | 6388, 20316, 716189, 287470, 101098096, 480626, 508463, 100059307 |
Gene Symbol and Synonyms | SDF2 |
Uniprot Accession | Q99470 |
Uniprot Entry Name | SDF2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000132581 |
Target Classification | Not Available |
The protein encoded by this gene is believed to be a secretory protein. It has regions of similarity to hydrophilic segments of yeast mannosyltransferases. Its expression is ubiquitous and the gene appears to be relatively conserved among mammals. Alternate splicing results in both coding and non-coding variants. A pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Dec 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.