Human CCL7/FIC/MARC ORF/cDNA clone-Lentivirus particle (NM_006273)

Cat. No.: vGMLP000252

Pre-made Human CCL7/FIC/MARC Lentiviral expression plasmid for CCL7 lentivirus packaging, CCL7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCL7/FIC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000252 Human CCL7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000252
Gene Name CCL7
Accession Number NM_006273
Gene ID 6354
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 300 bp
Gene Alias FIC,MARC,MCP-3,MCP3,NC28,SCYA6,SCYA7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAAGCCTCTGCAGCACTTCTGTGTCTGCTGCTCACAGCAGCTGCTTTCAGCCCCCAGGGGCTTGCTCAGCCAGTTGGGATTAATACTTCAACTACCTGCTGCTACAGATTTATCAATAAGAAAATCCCTAAGCAGAGGCTGGAGAGCTACAGAAGGACCACCAGTAGCCACTGTCCCCGGGAAGCTGTAATCTTCAAGACCAAACTGGACAAGGAGATCTGTGCTGACCCCACACAGAAGTGGGTCCAGGACTTTATGAAGCACCTGGACAAGAAAACCCAAACTCCAAAGCTTTGA
ORF Protein Sequence MKASAALLCLLLTAAAFSPQGLAQPVGINTSTTCCYRFINKKIPKQRLESYRRTTSSHCPREAVIFKTKLDKEICADPTQKWVQDFMKHLDKKTQTPKL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0072-Ab Anti-CCL7/ FIC/ MARC functional antibody
    Target Antigen GM-Tg-g-SE0072-Ag CCL7 protein
    Cytokine cks-Tg-g-GM-SE0072 chemokine (C-C motif) ligand 7 (CCL7) protein & antibody
    ORF Viral Vector pGMLP000252 Human CCL7 Lentivirus plasmid
    ORF Viral Vector vGMLP000252 Human CCL7 Lentivirus particle


    Target information

    Target ID GM-SE0072
    Target Name CCL7
    Gene ID 6354, 714751
    Gene Symbol and Synonyms CCL7,FIC,MARC,MCP-3,MCP3,NC28,SCYA6,SCYA7
    Uniprot Accession P80098
    Uniprot Entry Name CCL7_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000108688
    Target Classification Not Available

    This gene encodes monocyte chemotactic protein 3, a secreted chemokine which attracts macrophages during inflammation and metastasis. It is a member of the C-C subfamily of chemokines which are characterized by having two adjacent cysteine residues. The protein is an in vivo substrate of matrix metalloproteinase 2, an enzyme which degrades components of the extracellular matrix. This gene is part of a cluster of C-C chemokine family members on chromosome 17q. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.