Human SUV39H1/H3-K9-HMTase 1/KMT1A ORF/cDNA clone-Lentivirus particle (NM_003173)

Cat. No.: vGMLP000110

Pre-made Human SUV39H1/H3-K9-HMTase 1/KMT1A Lentiviral expression plasmid for SUV39H1 lentivirus packaging, SUV39H1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SUV39H1/H3-K9-HMTase 1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000110 Human SUV39H1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000110
Gene Name SUV39H1
Accession Number NM_003173
Gene ID 6839
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1239 bp
Gene Alias H3-K9-HMTase 1,KMT1A,MG44,SUV39H
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGAAAATTTAAAAGGCTGCAGCGTGTGTTGCAAGTCTTCTTGGAATCAGCTGCAGGACCTGTGCCGCCTGGCCAAGCTCTCCTGCCCTGCCCTCGGTATCTCTAAGAGGAACCTCTATGACTTTGAAGTCGAGTACCTGTGCGATTACAAGAAGATCCGCGAACAGGAATATTACCTGGTGAAATGGCGTGGATATCCAGACTCAGAGAGCACCTGGGAGCCACGGCAGAATCTCAAGTGTGTGCGTATCCTCAAGCAGTTCCACAAGGACTTAGAAAGGGAGCTGCTCCGGCGGCACCACCGGTCAAAGACCCCCCGGCACCTGGACCCAAGCTTGGCCAACTACCTGGTGCAGAAGGCCAAGCAGAGGCGGGCGCTCCGTCGCTGGGAGCAGGAGCTCAATGCCAAGCGCAGCCATCTGGGACGCATCACTGTAGAGAATGAGGTGGACCTGGACGGCCCTCCGCGGGCCTTCGTGTACATCAATGAGTACCGTGTTGGTGAGGGCATCACCCTCAACCAGGTGGCTGTGGGCTGCGAGTGCCAGGACTGTCTGTGGGCACCCACTGGAGGCTGCTGCCCGGGGGCGTCACTGCACAAGTTTGCCTACAATGACCAGGGCCAGGTGCGGCTTCGAGCCGGGCTGCCCATCTACGAGTGCAACTCCCGCTGCCGCTGCGGCTATGACTGCCCAAATCGTGTGGTACAGAAGGGTATCCGATATGACCTCTGCATCTTCCGCACGGATGATGGGCGTGGCTGGGGCGTCCGCACCCTGGAGAAGATTCGCAAGAACAGCTTCGTCATGGAGTACGTGGGAGAGATCATTACCTCAGAGGAGGCAGAGCGGCGGGGCCAGATCTACGACCGTCAGGGCGCCACCTACCTCTTTGACCTGGACTACGTGGAGGACGTGTACACCGTGGATGCCGCCTACTATGGCAACATCTCCCACTTTGTCAACCACAGTTGTGACCCCAACCTGCAGGTGTACAACGTCTTCATAGACAACCTTGACGAGCGGCTGCCCCGCATCGCTTTCTTTGCCACAAGAACCATCCGGGCAGGCGAGGAGCTCACCTTTGATTACAACATGCAAGTGGACCCCGTGGACATGGAGAGCACCCGCATGGACTCCAACTTTGGCCTGGCTGGGCTCCCTGGCTCCCCTAAGAAGCGGGTCCGTATTGAATGCAAGTGTGGGACTGAGTCCTGCCGCAAATACCTCTTCTAG
ORF Protein Sequence MAENLKGCSVCCKSSWNQLQDLCRLAKLSCPALGISKRNLYDFEVEYLCDYKKIREQEYYLVKWRGYPDSESTWEPRQNLKCVRILKQFHKDLERELLRRHHRSKTPRHLDPSLANYLVQKAKQRRALRRWEQELNAKRSHLGRITVENEVDLDGPPRAFVYINEYRVGEGITLNQVAVGCECQDCLWAPTGGCCPGASLHKFAYNDQGQVRLRAGLPIYECNSRCRCGYDCPNRVVQKGIRYDLCIFRTDDGRGWGVRTLEKIRKNSFVMEYVGEIITSEEAERRGQIYDRQGATYLFDLDYVEDVYTVDAAYYGNISHFVNHSCDPNLQVYNVFIDNLDERLPRIAFFATRTIRAGEELTFDYNMQVDPVDMESTRMDSNFGLAGLPGSPKKRVRIECKCGTESCRKYLF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T39519-Ab Anti-SUV39H1 monoclonal antibody
    Target Antigen GM-Tg-g-T39519-Ag SUV39H1 protein
    ORF Viral Vector pGMLP000110 Human SUV39H1 Lentivirus plasmid
    ORF Viral Vector vGMLP000110 Human SUV39H1 Lentivirus particle


    Target information

    Target ID GM-T39519
    Target Name SUV39H1
    Gene ID 6839, 20937, 711040, 302553, 101083571, 491868, 523047, 100062108
    Gene Symbol and Synonyms DXHXS7466e,H3-K9-HMTase 1,KMT1A,MG44,mIS6,RGD1565028,SUV39H,SUV39H1,Suv39h1l1
    Uniprot Accession O43463
    Uniprot Entry Name SUV91_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000101945
    Target Classification Not Available

    This gene encodes an evolutionarily-conserved protein containing an N-terminal chromodomain and a C-terminal SET domain. The encoded protein is a histone methyltransferase that trimethylates lysine 9 of histone H3, which results in transcriptional gene silencing. Loss of function of this gene disrupts heterochromatin formation and may cause chromosome instability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.