Human IL34/C16orf77/ IL-34 ORF/cDNA clone-Lentivirus particle (NM_001172772)

Pre-made Human IL34/C16orf77/ IL-34 Lentiviral expression plasmid for IL34 lentivirus packaging, IL34 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL34/C16orf77 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP-IL-038 Human IL34 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP-IL-038
Gene Name IL34
Accession Number NM_001172772
Gene ID 146433
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 729 bp
Gene Alias C16orf77, IL-34
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCCCGGGGCTTCACCTGGCTGCGCTATCTTGGGATCTTCCTTGGCGTGGCCTTGGGGAATGAGCCTTTGGAGATGTGGCCCTTGACGCAGAATGAGGAGTGCACTGTCACGGGTTTTCTGCGGGACAAGCTGCAGTACAGGAGCCGACTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGTGTGCCTTACGAGGGGGTGTTCAGAATCGCCAACGTCACCAGGCTGCAGAGGGCCCAGGTGAGCGAGCGGGAGCTGCGGTATCTGTGGGTCTTGGTGAGCCTCAGTGCCACTGAGTCGGTGCAGGACGTGCTGCTCGAGGGCCACCCATCCTGGAAGTACCTGCAGGAGGTGGAGACGCTGCTGCTGAATGTCCAGCAGGGCCTCACGGATGTGGAGGTCAGCCCCAAGGTGGAATCCGTGTTGTCCCTCTTGAATGCCCCAGGGCCAAACCTGAAGCTGGTGCGGCCCAAAGCCCTGCTGGACAACTGCTTCCGGGTCATGGAGCTGCTGTACTGCTCCTGCTGTAAACAAAGCTCCGTCCTAAACTGGCAGGACTGTGAGGTGCCAAGTCCTCAGTCTTGCAGCCCAGAGCCCTCATTGCAGTATGCGGCCACCCAGCTGTACCCTCCGCCCCCGTGGTCCCCCAGCTCCCCGCCTCACTCCACGGGCTCGGTGAGGCCGGTCAGGGCACAGGGCGAGGGCCTCTTGCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1028-Ab Anti-IL34/ C16orf77/ IL-34 functional antibody
    Target Antigen GM-Tg-g-SE1028-Ag IL34 protein
    ORF Viral Vector pGMLV000372 Human IL34 Lentivirus plasmid
    ORF Viral Vector pGMPC000680 Human IL34 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP-IL-038 Human IL34 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-121 Human IL34 Adenovirus plasmid
    ORF Viral Vector vGMLV000372 Human IL34 Lentivirus particle
    ORF Viral Vector vGMLP-IL-038 Human IL34 Lentivirus particle
    ORF Viral Vector vGMAP-IL-121 Human IL34 Adenovirus particle


    Target information

    Target ID GM-SE1028
    Target Name IL34
    Gene ID 146433, 76527, 709034, 498951, 101094391, 610536, 508292, 100054703
    Gene Symbol and Synonyms 2010004A03Rik,C16orf77,C18H16ORF77,IL-34,IL34
    Uniprot Accession Q6ZMJ4
    Uniprot Entry Name IL34_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000157368
    Target Classification Not Available

    Interleukin-34 is a cytokine that promotes the differentiation and viability of monocytes and macrophages through the colony-stimulating factor-1 receptor (CSF1R; MIM 164770) (Lin et al., 2008 [PubMed 18467591]).[supplied by OMIM, May 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.