Human SPP1/BSPI/ETA-1 ORF/cDNA clone-Adenovirus particle (BC017387)

Cat. No.: vGMAP000451

Pre-made Human SPP1/BSPI/ETA-1 Adenovirus for SPP1 overexpression in-vitro and in-vivo. The SPP1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SPP1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to SPP1/BSPI products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000451 Human SPP1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000451
Gene Name SPP1
Accession Number BC017387
Gene ID 6696
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 945 bp
Gene Alias BSPI,ETA-1
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAACAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGCTTTACAACAAATACCCAGATGCTGTGGCCACATGGCTAAACCCTGACCCATCTCAGAAGCAGAATCTCCTAGCCCCACAGAATGCTGTGTCCTCTGAAGAAACCAATGACTTTAAACAAGAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGATATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGACTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGATGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCACTCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACTGAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGAGGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGTTGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAACGAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTAA
ORF Protein Sequence MRIAVICFCLLGITCAIPVKQADSGSSEEKQLYNKYPDAVATWLNPDPSQKQNLLAPQNAVSSEETNDFKQETLPSKSNESHDHMDDMDDEDDDDHVDSQDSIDSNDSDDVDDTDDSHQSDESHHSDESDELVTDFPTDLPATEVFTPVVPTVDTYDGRGDSVVYGLRSKSKKFRRPDIQYPDATDEDITSHMESEELNGAYKAIPVAQDLNAPSDWDSRGKDSYETSQLDDQSAETHSHKQSRLYKRKANDESNEHSDVIDSQELSKVSREFHSHEFHSHEDMLVVDPKSKEEDKHLKFRISHELDSASSEVN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T00032-Ab Anti-OSTP/ SPP1/ BNSP functional antibody
    Target Antigen GM-Tg-g-T00032-Ag SPP1 protein
    ORF Viral Vector pGMLV000419 Human SPP1 Lentivirus plasmid
    ORF Viral Vector pGMLV001852 Human SPP1 Lentivirus plasmid
    ORF Viral Vector pGMAD000016 Human SPP1 Adenovirus plasmid
    ORF Viral Vector pGMAD000037 Human SPP1 Adenovirus plasmid
    ORF Viral Vector pGMAD001612 Human SPP1 Adenovirus plasmid
    ORF Viral Vector pGMAP000451 Human SPP1 Adenovirus plasmid
    ORF Viral Vector pGMPC000786 Human SPP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000419 Human SPP1 Lentivirus particle
    ORF Viral Vector vGMLV001852 Human SPP1 Lentivirus particle
    ORF Viral Vector vGMAD000016 Human SPP1 Adenovirus particle
    ORF Viral Vector vGMAD000037 Human SPP1 Adenovirus particle
    ORF Viral Vector vGMAD001612 Human SPP1 Adenovirus particle
    ORF Viral Vector vGMAP000451 Human SPP1 Adenovirus particle


    Target information

    Target ID GM-T00032
    Target Name SPP1
    Gene ID 6696, 20750, 704930, 25353, 101094264, 478471, 281499, 100053029
    Gene Symbol and Synonyms 2AR,Apl-1,BNSP,Bsp,BSPI,Eta,ETA-1,OP,OPN,Opnl,OSP,OST,Ric,Spp-1,SPP1
    Uniprot Accession P10451
    Uniprot Entry Name OSTP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Ovarian cancer, Acute kidney failure, Asphyxia neonatorum, Calculus of kidney, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to uranium, Dent disease, Hepatic fibrosis, Malignant neoplasm of bladder, Pregnant state, Sepsis
    Gene Ensembl ENSG00000118785
    Target Classification Not Available

    The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.