Human F10/FX/ FXA ORF/cDNA clone-Adenovirus particle (BC046125)
Pre-made Human F10/FX/ FXA Adenovirus for F10 overexpression in-vitro and in-vivo. The F10 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified F10-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to F10/FX products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000423 | Human F10 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000423 |
Gene Name | F10 |
Accession Number | BC046125 |
Gene ID | 2159 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1467 bp |
Gene Alias | FX, FXA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGCGCCCACTGCACCTCGTCCTGCTCAGTGCCTCCCTGGCTGGCCTCCTGCTGCTCGGGGAAAGTCTGTTCATCCGCAGGGAGCAGGCCAACAACATCCTGGCGAGGGTCACGAGGGCCAATTCCTTTCTTGAAGAGATGAAGAAAGGACACCTCGAAAGAGAGTGCATGGAAGAGACCTGCTCATACGAAGAGGCCCGCGAGGTCTTTGAGGACAGCGACAAGACGAATGAATTCTGGAATAAATACAAAGATGGCGACCAGTGTGAGACCAGTCCTTGCCAGAACCAGGGCAAATGTAAAGACGGCCTCGGGGAATACACCTGCACCTGTTTAGAAGGATTCGAAGGCAAAAACTGTGAATTATTCACACGGAAGCTCTGCAGCCTGGACAACGGGGACTGTGACCAGTTCTGCCACGAGGAACAGAACTCTGTGGTGTGCTCCTGCGCCCGCGGGTACACCCTGGCTGACAACGGCAAGGCCTGCATTCCCACAGGGCCCTACCCCTGTGGGAAACAGACCCTGGAACGCAGGAAGAGGTCAGTGGCCCAGGCCACCAGCAGCAGCGGGGAGGCCCCTGACAGCATCACATGGAAGCCATATGATGCAGCCGACCTGGACCCCACCGAGAACCCCTTCGACCTGCTTGACTTCAACCAGACGCAGCCTGAGAGGGGCGACAACAACCTCACCAGGATCGTGGGAGGCCAGGAATGCAAGGACGGGGAGTGTCCCTGGCAGGCCCTGCTCATCAATGAGGAAAACGAGGGTTTCTGTGGTGGAACTATTCTGAGCGAGTTCTACATCCTAACGGCAGCCCACTGTCTCTACCAAGCCAAGAGATTCAAGGTGAGGGTAGGGGACCGGAACACGGAGCAGGAGGAGGGCGGTGAGGCGGTGCACGAGGTGGAGGTGGTCATCAAGCACAACCGGTTCACAAAGGAGACCTATGACTTCGACATCGCCGTGCTCCGGCTCAAGACCCCCATCACCTTCCGCATGAACGTGGCGCCTGCCTGCCTCCCCGAGCGTGACTGGGCCGAGTCCACGCTGATGACGCAGAAGACGGGGATTGTGAGCGGCTTCGGGCGCACCCACGAGAAGGGCCGGCAGTCCACCAGGCTCAAGATGCTGGAGGTGCCCTACGTGGACCGCAACAGCTGCAAGCTGTCCAGCAGCTTCATCATCACCCAGAACATGTTCTGTGCCGGCTACGACACCAAGCAGGAGGATGCCTGCCAGGGGGACAGCGGGGGCCCGCACGTCACCCGCTTCAAGGACACCTACTTCGTGACAGGCATCGTCAGCTGGGGAGAGGGCTGTGCCCGTAAGGGGAAGTACGGGATCTACACCAAGGTCACCGCCTTCCTCAAGTGGATCGACAGGTCCATGAAAACCAGGGGCTTGCCCAAGGCCAAGAGCCATGCCCCGGAGGTCATAACGTCCTCTCCATTAAAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-177 | Pre-Made Emicizumab biosimilar, Bispecific mAb, Anti-F9;F10 Antibody: Anti-FIX/HEMB/P19/PTC/THPH8;FX/FXA therapeutic antibody |
Target Antibody | GM-Tg-g-T84631-Ab | Anti-FA10/ F10/ FX monoclonal antibody |
Target Antigen | GM-Tg-g-T84631-Ag | F10 VLP (virus-like particle) |
ORF Viral Vector | pGMAP000423 | Human F10 Adenovirus plasmid |
ORF Viral Vector | vGMAP000423 | Human F10 Adenovirus particle |
Target information
Target ID | GM-T84631 |
Target Name | F10 |
Gene ID | 2159, 14058, 714132, 29243, 476993, 280787, 100067094 |
Gene Symbol and Synonyms | Cf10,F10,FX,FXA |
Uniprot Accession | P00742 |
Uniprot Entry Name | FA10_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | Not Available |
Gene Ensembl | ENSG00000126218 |
Target Classification | Not Available |
This gene encodes the vitamin K-dependent coagulation factor X of the blood coagulation cascade. This factor undergoes multiple processing steps before its preproprotein is converted to a mature two-chain form by the excision of the tripeptide RKR. Two chains of the factor are held together by 1 or more disulfide bonds; the light chain contains 2 EGF-like domains, while the heavy chain contains the catalytic domain which is structurally homologous to those of the other hemostatic serine proteases. The mature factor is activated by the cleavage of the activation peptide by factor IXa (in the intrisic pathway), or by factor VIIa (in the extrinsic pathway). The activated factor then converts prothrombin to thrombin in the presence of factor Va, Ca+2, and phospholipid during blood clotting. Mutations of this gene result in factor X deficiency, a hemorrhagic condition of variable severity. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature polypeptides. [provided by RefSeq, Aug 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.