Human F10/FX/ FXA ORF/cDNA clone-Adenovirus particle (BC046125)

Pre-made Human F10/FX/ FXA Adenovirus for F10 overexpression in-vitro and in-vivo. The F10 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified F10-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to F10/FX products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000423 Human F10 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000423
Gene Name F10
Accession Number BC046125
Gene ID 2159
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1467 bp
Gene Alias FX, FXA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGCGCCCACTGCACCTCGTCCTGCTCAGTGCCTCCCTGGCTGGCCTCCTGCTGCTCGGGGAAAGTCTGTTCATCCGCAGGGAGCAGGCCAACAACATCCTGGCGAGGGTCACGAGGGCCAATTCCTTTCTTGAAGAGATGAAGAAAGGACACCTCGAAAGAGAGTGCATGGAAGAGACCTGCTCATACGAAGAGGCCCGCGAGGTCTTTGAGGACAGCGACAAGACGAATGAATTCTGGAATAAATACAAAGATGGCGACCAGTGTGAGACCAGTCCTTGCCAGAACCAGGGCAAATGTAAAGACGGCCTCGGGGAATACACCTGCACCTGTTTAGAAGGATTCGAAGGCAAAAACTGTGAATTATTCACACGGAAGCTCTGCAGCCTGGACAACGGGGACTGTGACCAGTTCTGCCACGAGGAACAGAACTCTGTGGTGTGCTCCTGCGCCCGCGGGTACACCCTGGCTGACAACGGCAAGGCCTGCATTCCCACAGGGCCCTACCCCTGTGGGAAACAGACCCTGGAACGCAGGAAGAGGTCAGTGGCCCAGGCCACCAGCAGCAGCGGGGAGGCCCCTGACAGCATCACATGGAAGCCATATGATGCAGCCGACCTGGACCCCACCGAGAACCCCTTCGACCTGCTTGACTTCAACCAGACGCAGCCTGAGAGGGGCGACAACAACCTCACCAGGATCGTGGGAGGCCAGGAATGCAAGGACGGGGAGTGTCCCTGGCAGGCCCTGCTCATCAATGAGGAAAACGAGGGTTTCTGTGGTGGAACTATTCTGAGCGAGTTCTACATCCTAACGGCAGCCCACTGTCTCTACCAAGCCAAGAGATTCAAGGTGAGGGTAGGGGACCGGAACACGGAGCAGGAGGAGGGCGGTGAGGCGGTGCACGAGGTGGAGGTGGTCATCAAGCACAACCGGTTCACAAAGGAGACCTATGACTTCGACATCGCCGTGCTCCGGCTCAAGACCCCCATCACCTTCCGCATGAACGTGGCGCCTGCCTGCCTCCCCGAGCGTGACTGGGCCGAGTCCACGCTGATGACGCAGAAGACGGGGATTGTGAGCGGCTTCGGGCGCACCCACGAGAAGGGCCGGCAGTCCACCAGGCTCAAGATGCTGGAGGTGCCCTACGTGGACCGCAACAGCTGCAAGCTGTCCAGCAGCTTCATCATCACCCAGAACATGTTCTGTGCCGGCTACGACACCAAGCAGGAGGATGCCTGCCAGGGGGACAGCGGGGGCCCGCACGTCACCCGCTTCAAGGACACCTACTTCGTGACAGGCATCGTCAGCTGGGGAGAGGGCTGTGCCCGTAAGGGGAAGTACGGGATCTACACCAAGGTCACCGCCTTCCTCAAGTGGATCGACAGGTCCATGAAAACCAGGGGCTTGCCCAAGGCCAAGAGCCATGCCCCGGAGGTCATAACGTCCTCTCCATTAAAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-177 Pre-Made Emicizumab biosimilar, Bispecific mAb, Anti-F9;F10 Antibody: Anti-FIX/HEMB/P19/PTC/THPH8;FX/FXA therapeutic antibody
    Target Antibody GM-Tg-g-T84631-Ab Anti-FA10/ F10/ FX monoclonal antibody
    Target Antigen GM-Tg-g-T84631-Ag F10 VLP (virus-like particle)
    ORF Viral Vector pGMAP000423 Human F10 Adenovirus plasmid
    ORF Viral Vector vGMAP000423 Human F10 Adenovirus particle


    Target information

    Target ID GM-T84631
    Target Name F10
    Gene ID 2159, 14058, 714132, 29243, 476993, 280787, 100067094
    Gene Symbol and Synonyms Cf10,F10,FX,FXA
    Uniprot Accession P00742
    Uniprot Entry Name FA10_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000126218
    Target Classification Not Available

    This gene encodes the vitamin K-dependent coagulation factor X of the blood coagulation cascade. This factor undergoes multiple processing steps before its preproprotein is converted to a mature two-chain form by the excision of the tripeptide RKR. Two chains of the factor are held together by 1 or more disulfide bonds; the light chain contains 2 EGF-like domains, while the heavy chain contains the catalytic domain which is structurally homologous to those of the other hemostatic serine proteases. The mature factor is activated by the cleavage of the activation peptide by factor IXa (in the intrisic pathway), or by factor VIIa (in the extrinsic pathway). The activated factor then converts prothrombin to thrombin in the presence of factor Va, Ca+2, and phospholipid during blood clotting. Mutations of this gene result in factor X deficiency, a hemorrhagic condition of variable severity. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature polypeptides. [provided by RefSeq, Aug 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.