Human PIM1 ORF/cDNA clone-Adenovirus particle (BC020224)

Cat. No.: vGMAP000309

Pre-made Human PIM1/ Adenovirus for PIM1 overexpression in-vitro and in-vivo. The PIM1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PIM1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to PIM1/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000309 Human PIM1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000309
Gene Name PIM1
Accession Number BC020224
Gene ID 5292
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 942 bp
Gene Alias
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCTTGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTGCACGCCACCAAGCTGGCGCCCGGCAAGGAGAAGGAGCCCCTGGAGTCGCAGTACCAGGTGGGCCCGCTACTGGGCAGCGGCGGCTTCGGCTCGGTCTACTCAGGCATCCGCGTCTCCGACAACTTGCCGGTGGCCATCAAACACGTGGAGAAGGACCGGATTTCCGACTGGGGAGAGCTGCCTAATGGCACTCGAGTGCCCATGGAAGTGGTCCTGCTGAAGAAGGTGAGCTCGGGTTTCTCCGGCGTCATTAGGCTCCTGGACTGGTTCGAGAGGCCCGACAGTTTCGTCCTGATCCTGGAGAGGCCCGAGCCGGTGCAAGATCTCTTCGACTTCATCACGGAAAGGGGAGCCCTGCAAGAGGAGCTGGCCCGCAGCTTCTTCTGGCAGGTGCTGGAGGCCGTGCGGCACTGCCACAACTGCGGGGTGCTCCACCGCGACATCAAGGACGAAAACATCCTTATCGACCTCAATCGCGGCGAGCTCAAGCTCATCGACTTCGGGTCGGGGGCGCTGCTCAAGGACACCGTCTACACGGACTTCGATGGGACCCGAGTGTATAGCCCTCCAGAGTGGATCCGCTACCATCGCTACCATGGCAGGTCGGCGGCAGTCTGGTCCCTGGGGATCCTGCTGTATGATATGGTGTGTGGAGATATTCCTTTCGAGCATGACGAAGAGATCATCAGGGGCCAGGTTTTCTTCAGGCAGAGGGTCTCTTCAGAATGTCAGCATCTCATTAGATGGTGCTTGGCCCTGAGACCATCAGATAGGCCAACCTTCGAAGAAATCCAGAACCATCCATGGATGCAAGATGTTCTCCTGCCCCAGGAAACTGCTGAGATCCACCTCCACAGCCTGTCGCCGGGGCCCAGCAAATAG
ORF Protein Sequence MLLSKINSLAHLRAAPCNDLHATKLAPGKEKEPLESQYQVGPLLGSGGFGSVYSGIRVSDNLPVAIKHVEKDRISDWGELPNGTRVPMEVVLLKKVSSGFSGVIRLLDWFERPDSFVLILERPEPVQDLFDFITERGALQEELARSFFWQVLEAVRHCHNCGVLHRDIKDENILIDLNRGELKLIDFGSGALLKDTVYTDFDGTRVYSPPEWIRYHRYHGRSAAVWSLGILLYDMVCGDIPFEHDEEIIRGQVFFRQRVSSECQHLIRWCLALRPSDRPTFEEIQNHPWMQDVLLPQETAEIHLHSLSPGPSK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T50594-Ab Anti-PIM1 monoclonal antibody
    Target Antigen GM-Tg-g-T50594-Ag PIM1 protein
    ORF Viral Vector pGMLP005380 Human PIM1 Lentivirus plasmid
    ORF Viral Vector pGMLV001605 Human PIM1 Lentivirus plasmid
    ORF Viral Vector pGMAD001584 Human PIM1 Adenovirus plasmid
    ORF Viral Vector pGMAP000309 Human PIM1 Adenovirus plasmid
    ORF Viral Vector pGMPC000811 Human PIM1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005380 Human PIM1 Lentivirus particle
    ORF Viral Vector vGMLV001605 Human PIM1 Lentivirus particle
    ORF Viral Vector vGMAD001584 Human PIM1 Adenovirus particle
    ORF Viral Vector vGMAP000309 Human PIM1 Adenovirus particle


    Target information

    Target ID GM-T50594
    Target Name PIM1
    Gene ID 5292, 18712, 114677751, 24649, 493888, 281402, 100053898
    Gene Symbol and Synonyms PIM,Pim-1,PIM1
    Uniprot Accession P11309
    Uniprot Entry Name PIM1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000137193
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and PIM subfamily. This gene is expressed primarily in B-lymphoid and myeloid cell lines, and is overexpressed in hematopoietic malignancies and in prostate cancer. It plays a role in signal transduction in blood cells, contributing to both cell proliferation and survival, and thus provides a selective advantage in tumorigenesis. Both the human and orthologous mouse genes have been reported to encode two isoforms (with preferential cellular localization) resulting from the use of alternative in-frame translation initiation codons, the upstream non-AUG (CUG) and downstream AUG codons (PMIDs:16186805, 1825810).[provided by RefSeq, Aug 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.