Human CD40LG/CD154/CD40L ORF/cDNA clone-Adenovirus particle (BC071754)

Cat. No.: vGMAP000295

Pre-made Human CD40LG/CD154/CD40L Adenovirus for CD40LG overexpression in-vitro and in-vivo. The CD40LG adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CD40LG-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to CD40LG/CD154 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000295 Human CD40LG Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000295
Gene Name CD40LG
Accession Number BC071754
Gene ID 959
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 786 bp
Gene Alias CD154,CD40L,gp39,hCD40L,IGM,T-BAM,TRAP
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGATCGAAACATACAACCAAACTTCTCCCCGATCTGCGGCCACTGGACTGCCCATCAGCATGAAAATTTTTATGTATTTACTTACTGTTTTTCTTATCACCCAGATGATTGGGTCAGCACTTTTTGCTGTGTATCTTCATAGAAGGTTGGACAAGATAGAAGATGAAAGGAATCTTCATGAAGATTTTGTATTCATGAAAACGATACAGAGATGCAACACAGGAGAAAGATCCTTATCCTTACTGAACTGTGAGGAGATTAAAAGCCAGTTTGAAGGCTTTGTGAAGGATATAATGTTAAACAAAGAGGAGACGAAGAAAGAAAACAGCTTTGAAATGCAAAAAGGTGATCAGAATCCTCAAATTGCGGCACATGTCATAAGTGAGGCCAGCAGTAAAACAACATCTGTGTTACAGTGGGCTGAAAAAGGATACTACACCATGAGCAACAACTTGGTAACCCTGGAAAATGGGAAACAGCTGACCGTTAAAAGACAAGGACTCTATTATATCTATGCCCAAGTCACCTTCTGTTCCAATCGGGAAGCTTCGAGTCAAGCTCCATTTATAGCCAGCCTCTGCCTAAAGTCCCCCGGTAGATTCGAGAGAATCTTACTCAGAGCTGCAAATACCCACAGTTCCGCCAAACCTTGCGGGCAACAATCCATTCACTTGGGAGGAGTATTTGAATTGCAACCAGGTGCTTCGGTGTTTGTCAATGTGACTGATCCAAGCCAAGTGAGCCATGGCACTGGCTTCACGTCCTTTGGCTTACTCAAACTCTGA
ORF Protein Sequence MIETYNQTSPRSAATGLPISMKIFMYLLTVFLITQMIGSALFAVYLHRRLDKIEDERNLHEDFVFMKTIQRCNTGERSLSLLNCEEIKSQFEGFVKDIMLNKEETKKENSFEMQKGDQNPQIAAHVISEASSKTTSVLQWAEKGYYTMSNNLVTLENGKQLTVKRQGLYYIYAQVTFCSNREASSQAPFIASLCLKSPGRFERILLRAANTHSSAKPCGQQSIHLGGVFELQPGASVFVNVTDPSQVSHGTGFTSFGLLKL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-132 Pre-Made Dapirolizumab biosimilar, Fab, Anti-CD40LG Antibody: Anti-IGM/IMD3/TRAP/gp39/CD154/CD40L/HIGM1/T-BAM/TNFSF5/hCD40L therapeutic antibody
    Biosimilar GMP-Bios-ab-501 Pre-Made Ruplizumab biosimilar, Whole mAb, Anti-CD40LG Antibody: Anti-IGM/IMD3/TRAP/gp39/CD154/CD40L/HIGM1/T-BAM/TNFSF5/hCD40L therapeutic antibody
    Biosimilar GMP-Bios-INN-1026 Pre-Made Toralizumab Biosimilar, Whole Mab, Anti-Cd40Lg Antibody: Anti-CD154/CD40L/HIGM1/IGM/IMD3/T-BAM/TNFSF5/TRAP/gp39/hCD40L therapeutic antibody
    Biosimilar GMP-Bios-INN-798 Pre-Made Dazodalibep Biosimilar, Fusion Protein targeting CD40LG fused with ALB (albumin, human serum albumin, HSA): Recombinant therapeutic protein targeting CD154/CD40L/HIGM1/IGM/IMD3/T-BAM/TNFSF5/TRAP/gp39/hCD40L
    Biosimilar GMP-Bios-ab-307 Pre-Made Letolizumab biosimilar, Single Domain Variable Fragment;H, Anti-CD40LG Antibody: Anti-IGM/IMD3/TRAP/gp39/CD154/CD40L/HIGM1/T-BAM/TNFSF5/hCD40L therapeutic antibody
    Target Antibody GM-Tg-g-T14755-Ab Anti-CD40L/ CD40LG/ CD154 monoclonal antibody
    Target Antigen GM-Tg-g-T14755-Ag CD40LG VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T14755 CD40 ligand (CD154) protein & antibody
    ORF Viral Vector pGMLV000459 Human CD40LG Lentivirus plasmid
    ORF Viral Vector pGMAP000295 Human CD40LG Adenovirus plasmid
    ORF Viral Vector vGMLV000459 Human CD40LG Lentivirus particle
    ORF Viral Vector vGMAP000295 Human CD40LG Adenovirus particle


    Target information

    Target ID GM-T14755
    Target Name CD40LG
    Gene ID 959, 21947, 574160, 84349, 493850, 403468, 100054624
    Gene Symbol and Synonyms CD154,CD40-L,CD40L,CD40LG,gp39,hCD40L,HIGM1,IGM,IMD3,Ly-62,Ly62,T-BAM,TNFSF5,Tnlg8b,TRAP
    Uniprot Accession P29965
    Uniprot Entry Name CD40L_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000102245
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is expressed on the surface of T cells. It regulates B cell function by engaging CD40 on the B cell surface. A defect in this gene results in an inability to undergo immunoglobulin class switch and is associated with hyper-IgM syndrome. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.