Human PLAUR/CD87/UPAR ORF/cDNA clone-Adenovirus particle (BC002788)

SKU: vGMAP000173
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PLAUR/CD87/UPAR Adenovirus for PLAUR overexpression in-vitro and in-vivo. The PLAUR adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PLAUR-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.


Target products collection

Go to PLAUR/CD87 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000173 Human PLAUR Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000173
Gene Name PLAUR
Accession Number BC002788
Gene ID 5329
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1008 bp
Gene Alias CD87,UPAR,URKR
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
Sequence ATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAGCCTCTTGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGTGCGCCCTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAGAGCTGGAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCTATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCTGAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGCGTCCAAAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCAATGGTTTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCAACGAGGGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCTGCAAGGGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCCATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATATGGTAAGAGGCTGTGCAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGCATGAACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTCCAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCTCACCATCACCCTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T74363-Ab Anti-UPAR/ PLAUR/ CD87 monoclonal antibody
    Target Antigen GM-Tg-g-T74363-Ag PLAUR VLP (virus-like particle)
    ORF Viral Vector pGMAP000173 Human PLAUR Adenovirus plasmid
    ORF Viral Vector vGMAP000173 Human PLAUR Adenovirus particle


    Target information

    Target ID GM-T74363
    Target Name PLAUR
    Gene ID 5329, 18793, 710662, 50692, 101091240, 281983, 100033904
    Gene Symbol and Synonyms CD87,Par,PLAUR,Plaur3,U-PAR,UPAR,uPAR-2,uPAR-3,URKR
    Uniprot Accession Q03405
    Uniprot Entry Name UPAR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Nephrotic syndrome with focal and segmental glomerular lesions, Kidney transplant rejection, Chronic Kidney Disease
    Gene Ensembl ENSG00000011422
    Target Classification Not Available

    This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.