- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CHEK1/CHK1 ORF/cDNA clone-Adenovirus particle (NM_001274)
Pre-made Human CHEK1/CHK1 Adenovirus for CHEK1 overexpression in-vitro and in-vivo. The CHEK1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CHEK1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CHK1/CHEK1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-144 | Human CHEK1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-144 |
| Gene Name | CHEK1 |
| Accession Number | NM_001274 |
| Gene ID | 1111 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1431 bp |
| Gene Alias | CHK1 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTATGGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTAGATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAAATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAATATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATAGGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTATCTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAAAGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGTGAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAGAGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCAATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGACTGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCTCTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAAAAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCAGGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTCTCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAACCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAAGGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTTGGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTCTTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTGGGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGAAACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGACTTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGGAAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T62449-Ab | Anti-CHK1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T62449-Ag | CHK1/CHEK1 protein |
| ORF Viral Vector | pGMLP003747 | Human CHEK1 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-004 | Human CHEK1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-144 | Human CHEK1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP003747 | Human CHEK1 Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-004 | Human CHEK1 Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-144 | Human CHEK1 Adenovirus particle |
Target information
| Target ID | GM-T62449 |
| Target Name | CHK1 |
| Gene ID | 1111, 12649, 713358, 140583, 101083365, 609767, 513678, 100064353 |
| Gene Symbol and Synonyms | CHEK1,CHK1,rad27 |
| Uniprot Accession | O14757 |
| Uniprot Entry Name | CHK1_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000149554 |
| Target Classification | Kinase, Tumor-associated antigen (TAA) |
The protein encoded by this gene belongs to the Ser/Thr protein kinase family. It is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. This protein acts to integrate signals from ATM and ATR, two cell cycle proteins involved in DNA damage responses, that also associate with chromatin in meiotic prophase I. Phosphorylation of CDC25A protein phosphatase by this protein is required for cells to delay cell cycle progression in response to double-strand DNA breaks. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
