Human TNFRSF1A/CD120a/FPF ORF/cDNA clone-Adenovirus particle (NM_001065.3)

Cat. No.: vGMAD000422

Pre-made Human TNFRSF1A/CD120a/FPF Adenovirus for TNFRSF1A overexpression in-vitro and in-vivo. The TNFRSF1A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TNFRSF1A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to TNF-R1/TNFRSF1A/CD120a products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000422 Human TNFRSF1A Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000422
Gene Name TNFRSF1A
Accession Number NM_001065.3
Gene ID 7132
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1368 bp
Gene Alias CD120a,FPF,p55,p55-R,p60,TBP1,TNF-R,TNF-R-I,TNF-R55,TNFAR,TNFR1,TNFR55,TNFR60
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag Null
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCCTCTCCACCGTGCCTGACCTGCTGCTGCCACTGGTGCTCCTGGAGCTGTTGGTGGGAATATACCCCTCAGGGGTTATTGGACTGGTCCCTCACCTAGGGGACAGGGAGAAGAGAGATAGTGTGTGTCCCCAAGGAAAATATATCCACCCTCAAAATAATTCGATTTGCTGTACCAAGTGCCACAAAGGAACCTACTTGTACAATGACTGTCCAGGCCCGGGGCAGGATACGGACTGCAGGGAGTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAACCACCTCAGACACTGCCTCAGCTGCTCCAAATGCCGAAAGGAAATGGGTCAGGTGGAGATCTCTTCTTGCACAGTGGACCGGGACACCGTGTGTGGCTGCAGGAAGAACCAGTACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAATTGCAGCCTCTGCCTCAATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACACCGTGTGCACCTGCCATGCAGGTTTCTTTCTAAGAGAAAACGAGTGTGTCTCCTGTAGTAACTGTAAGAAAAGCCTGGAGTGCACGAAGTTGTGCCTACCCCAGATTGAGAATGTTAAGGGCACTGAGGACTCAGGCACCACAGTGCTGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCCTCCTCTTCATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCCATTGTTTGTGGGAAATCGACACCTGAAAAAGAGGGGGAGCTTGAAGGAACTACTACTAAGCCCCTGGCCCCAAACCCAAGCTTCAGTCCCACTCCAGGCTTCACCCCCACCCTGGGCTTCAGTCCCGTGCCCAGTTCCACCTTCACCTCCAGCTCCACCTATACCCCCGGTGACTGTCCCAACTTTGCGGCTCCCCGCAGAGAGGTGGCACCACCCTATCAGGGGGCTGACCCCATCCTTGCGACAGCCCTCGCCTCCGACCCCATCCCCAACCCCCTTCAGAAGTGGGAGGACAGCGCCCACAAGCCACAGAGCCTAGACACTGATGACCCCGCGACGCTGTACGCCGTGGTGGAGAACGTGCCCCCGTTGCGCTGGAAGGAATTCGTGCGGCGCCTAGGGCTGAGCGACCACGAGATCGATCGGCTGGAGCTGCAGAACGGGCGCTGCCTGCGCGAGGCGCAATACAGCATGCTGGCGACCTGGAGGCGGCGCACGCCGCGGCGCGAGGCCACGCTGGAGCTGCTGGGACGCGTGCTCCGCGACATGGACCTGCTGGGCTGCCTGGAGGACATCGAGGAGGCGCTTTGCGGCCCCGCCGCCCTCCCGCCCGCGCCCAGTCTTCTCAGATGA
ORF Protein Sequence MGLSTVPDLLLPLVLLELLVGIYPSGVIGLVPHLGDREKRDSVCPQGKYIHPQNNSICCTKCHKGTYLYNDCPGPGQDTDCRECESGSFTASENHLRHCLSCSKCRKEMGQVEISSCTVDRDTVCGCRKNQYRHYWSENLFQCFNCSLCLNGTVHLSCQEKQNTVCTCHAGFFLRENECVSCSNCKKSLECTKLCLPQIENVKGTEDSGTTVLLPLVIFFGLCLLSLLFIGLMYRYQRWKSKLYSIVCGKSTPEKEGELEGTTTKPLAPNPSFSPTPGFTPTLGFSPVPSSTFTSSSTYTPGDCPNFAAPRREVAPPYQGADPILATALASDPIPNPLQKWEDSAHKPQSLDTDDPATLYAVVENVPPLRWKEFVRRLGLSDHEIDRLELQNGRCLREAQYSMLATWRRRTPRREATLELLGRVLRDMDLLGCLEDIEEALCGPAALPPAPSLLR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-1007 Pre-Made Tanfanercept biosimilar, Recombinant Protein: Recombinant therapeutic protein targeting TNF-α receptor
    Target Antibody GM-Tg-g-T86552-Ab Anti-TNR1A/ TNF-R1/ TNFRSF1A monoclonal antibody
    Target Antigen GM-Tg-g-T86552-Ag TNF-R1/TNFRSF1A VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T86552 Tumor necrosis factor receptor superfamily, member 1A (TNFRSF1A) protein & antibody
    ORF Viral Vector pGMAD000422 Human TNFRSF1A Adenovirus plasmid
    ORF Viral Vector vGMAD000422 Human TNFRSF1A Adenovirus particle


    Target information

    Target ID GM-T86552
    Target Name TNF-R1
    Gene ID 7132, 21937, 722033, 25625, 493957, 403634, 282527, 100059548
    Gene Symbol and Synonyms CD120a,FPF,p55,p55-R,p60,TBP1,TNF-alphaR1,TNF-R,TNF-R-I,TNF-R1,TNF-R55,TNFalpha-R1,TNFAR,TNFR I,TNFR-1,Tnfr-2,TNFR1,TNFR55,TNFR60,TNFRI,TNFRp55,TNFRSF1A
    Uniprot Accession P19438
    Uniprot Entry Name TNR1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Breast Cancer, tumor necrosis factor (TNF) receptor-associated periodic syndrome, Rheumatoid vasculitis with rheumatoid arthritis
    Gene Ensembl ENSG00000067182
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mutations in this gene underlie tumor necrosis factor receptor-associated periodic syndrome (TRAPS), characterized by fever, abdominal pain and other features. Mutations in this gene may also be associated with multiple sclerosis in human patients. [provided by RefSeq, Sep 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.