Human TNFRSF1A/CD120a/FPF ORF/cDNA clone-Adenovirus particle (NM_001065.3)
Cat. No.: vGMAD000422
Pre-made Human TNFRSF1A/CD120a/FPF Adenovirus for TNFRSF1A overexpression in-vitro and in-vivo. The TNFRSF1A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TNFRSF1A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
TNF-R1/TNFRSF1A/CD120a products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000422 | Human TNFRSF1A Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000422 |
Gene Name | TNFRSF1A |
Accession Number | NM_001065.3 |
Gene ID | 7132 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1368 bp |
Gene Alias | CD120a,FPF,p55,p55-R,p60,TBP1,TNF-R,TNF-R-I,TNF-R55,TNFAR,TNFR1,TNFR55,TNFR60 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | Null |
Promoter | EF1 |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGGCCTCTCCACCGTGCCTGACCTGCTGCTGCCACTGGTGCTCCTGGAGCTGTTGGTGGGAATATACCCCTCAGGGGTTATTGGACTGGTCCCTCACCTAGGGGACAGGGAGAAGAGAGATAGTGTGTGTCCCCAAGGAAAATATATCCACCCTCAAAATAATTCGATTTGCTGTACCAAGTGCCACAAAGGAACCTACTTGTACAATGACTGTCCAGGCCCGGGGCAGGATACGGACTGCAGGGAGTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAACCACCTCAGACACTGCCTCAGCTGCTCCAAATGCCGAAAGGAAATGGGTCAGGTGGAGATCTCTTCTTGCACAGTGGACCGGGACACCGTGTGTGGCTGCAGGAAGAACCAGTACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAATTGCAGCCTCTGCCTCAATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACACCGTGTGCACCTGCCATGCAGGTTTCTTTCTAAGAGAAAACGAGTGTGTCTCCTGTAGTAACTGTAAGAAAAGCCTGGAGTGCACGAAGTTGTGCCTACCCCAGATTGAGAATGTTAAGGGCACTGAGGACTCAGGCACCACAGTGCTGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCCTCCTCTTCATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCCATTGTTTGTGGGAAATCGACACCTGAAAAAGAGGGGGAGCTTGAAGGAACTACTACTAAGCCCCTGGCCCCAAACCCAAGCTTCAGTCCCACTCCAGGCTTCACCCCCACCCTGGGCTTCAGTCCCGTGCCCAGTTCCACCTTCACCTCCAGCTCCACCTATACCCCCGGTGACTGTCCCAACTTTGCGGCTCCCCGCAGAGAGGTGGCACCACCCTATCAGGGGGCTGACCCCATCCTTGCGACAGCCCTCGCCTCCGACCCCATCCCCAACCCCCTTCAGAAGTGGGAGGACAGCGCCCACAAGCCACAGAGCCTAGACACTGATGACCCCGCGACGCTGTACGCCGTGGTGGAGAACGTGCCCCCGTTGCGCTGGAAGGAATTCGTGCGGCGCCTAGGGCTGAGCGACCACGAGATCGATCGGCTGGAGCTGCAGAACGGGCGCTGCCTGCGCGAGGCGCAATACAGCATGCTGGCGACCTGGAGGCGGCGCACGCCGCGGCGCGAGGCCACGCTGGAGCTGCTGGGACGCGTGCTCCGCGACATGGACCTGCTGGGCTGCCTGGAGGACATCGAGGAGGCGCTTTGCGGCCCCGCCGCCCTCCCGCCCGCGCCCAGTCTTCTCAGATGA |
ORF Protein Sequence | MGLSTVPDLLLPLVLLELLVGIYPSGVIGLVPHLGDREKRDSVCPQGKYIHPQNNSICCTKCHKGTYLYNDCPGPGQDTDCRECESGSFTASENHLRHCLSCSKCRKEMGQVEISSCTVDRDTVCGCRKNQYRHYWSENLFQCFNCSLCLNGTVHLSCQEKQNTVCTCHAGFFLRENECVSCSNCKKSLECTKLCLPQIENVKGTEDSGTTVLLPLVIFFGLCLLSLLFIGLMYRYQRWKSKLYSIVCGKSTPEKEGELEGTTTKPLAPNPSFSPTPGFTPTLGFSPVPSSTFTSSSTYTPGDCPNFAAPRREVAPPYQGADPILATALASDPIPNPLQKWEDSAHKPQSLDTDDPATLYAVVENVPPLRWKEFVRRLGLSDHEIDRLELQNGRCLREAQYSMLATWRRRTPRREATLELLGRVLRDMDLLGCLEDIEEALCGPAALPPAPSLLR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-1007 | Pre-Made Tanfanercept biosimilar, Recombinant Protein: Recombinant therapeutic protein targeting TNF-α receptor |
Target Antibody | GM-Tg-g-T86552-Ab | Anti-TNR1A/ TNF-R1/ TNFRSF1A monoclonal antibody |
Target Antigen | GM-Tg-g-T86552-Ag | TNF-R1/TNFRSF1A VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T86552 | Tumor necrosis factor receptor superfamily, member 1A (TNFRSF1A) protein & antibody |
ORF Viral Vector | pGMAD000422 | Human TNFRSF1A Adenovirus plasmid |
ORF Viral Vector | vGMAD000422 | Human TNFRSF1A Adenovirus particle |
Target information
Target ID | GM-T86552 |
Target Name | TNF-R1 |
Gene ID | 7132, 21937, 722033, 25625, 493957, 403634, 282527, 100059548 |
Gene Symbol and Synonyms | CD120a,FPF,p55,p55-R,p60,TBP1,TNF-alphaR1,TNF-R,TNF-R-I,TNF-R1,TNF-R55,TNFalpha-R1,TNFAR,TNFR I,TNFR-1,Tnfr-2,TNFR1,TNFR55,TNFR60,TNFRI,TNFRp55,TNFRSF1A |
Uniprot Accession | P19438 |
Uniprot Entry Name | TNR1A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Breast Cancer, tumor necrosis factor (TNF) receptor-associated periodic syndrome, Rheumatoid vasculitis with rheumatoid arthritis |
Gene Ensembl | ENSG00000067182 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mutations in this gene underlie tumor necrosis factor receptor-associated periodic syndrome (TRAPS), characterized by fever, abdominal pain and other features. Mutations in this gene may also be associated with multiple sclerosis in human patients. [provided by RefSeq, Sep 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.