Human SCARB2/AMRF/CD36L2 ORF/cDNA clone-Adenovirus particle (NM_005506)

Cat. No.: vGMAD000184

Pre-made Human SCARB2/AMRF/CD36L2 Adenovirus for SCARB2 overexpression in-vitro and in-vivo. The SCARB2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SCARB2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to SCARB2/AMRF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000184 Human SCARB2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000184
Gene Name SCARB2
Accession Number NM_005506
Gene ID 950
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1437 bp
Gene Alias AMRF,CD36L2,EPM4,HLGP85,LGP85,LIMP-2,LIMPII,SR-BII
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCCGATGCTGCTTCTACACGGCGGGGACGTTGTCCCTGCTCCTGCTGGTGACCAGCGTCACGCTGCTGGTGGCCCGGGTCTTCCAGAAGGCTGTAGACCAGAGTATCGAGAAGAAAATTGTGTTAAGGAATGGTACTGAGGCATTTGACTCCTGGGAGAAGCCCCCTCTGCCTGTGTATACTCAGTTCTATTTCTTCAATGTCACCAATCCAGAGGAGATCCTCAGAGGGGAGACCCCTCGGGTGGAAGAAGTGGGGCCATACACCTACAGGGAACTCAGAAACAAAGCAAATATTCAATTTGGAGATAATGGAACAACAATATCTGCTGTTAGCAACAAGGCCTATGTTTTTGAACGAGACCAATCTGTTGGAGACCCTAAAATTGACTTAATTAGAACATTAAATATTCCTGTATTGACTGTCATAGAGTGGTCCCAGGTGCACTTCCTCAGGGAGATCATCGAGGCCATGTTGAAAGCCTATCAGCAGAAGCTCTTTGTGACTCACACAGTTGACGAATTGCTCTGGGGCTACAAAGATGAAATCTTGTCCCTTATCCATGTTTTCAGGCCCGATATCTCTCCCTATTTTGGCCTATTCTATGAGAAAAATGGGACTAATGATGGAGACTATGTTTTTCTAACTGGAGAAGACAGTTACCTTAACTTTACAAAAATTGTGGAATGGAATGGGAAAACGTCACTTGACTGGTGGATAACAGACAAGTGCAATATGATTAATGGAACAGATGGAGATTCTTTTCACCCACTAATAACCAAAGATGAGGTCCTTTATGTCTTCCCATCTGACTTTTGCAGGTCAGTGTATATTACTTTCAGTGACTATGAGAGTGTACAGGGACTGCCTGCCTTTCGGTATAAAGTTCCTGCAGAAATATTAGCCAATACGTCAGACAATGCCGGCTTCTGTATACCTGAGGGAAACTGCCTGGGCTCAGGAGTTCTGAATGTCAGCATCTGCAAGAATGGTGCACCCATCATTATGTCTTTCCCACACTTTTACCAAGCAGATGAGAGGTTTGTTTCTGCCATAGAAGGCATGCACCCAAATCAGGAAGACCATGAGACATTTGTGGACATTAATCCTTTGACTGGAATAATCCTAAAAGCAGCCAAGAGGTTCCAAATCAACATTTATGTCAAAAAATTAGATGACTTTGTTGAAACGGGAGACATTAGAACCATGGTTTTCCCAGTGATGTACCTCAATGAGAGTGTTCACATTGATAAAGAGACGGCGAGTCGACTGAAGTCTATGATTAACACTACTTTGATCATCACCAACATACCCTACATCATCATGGCGCTGGGTGTGTTCTTTGGTTTGGTTTTTACCTGGCTTGCATGCAAAGGACAGGGATCCATGGATGAGGGAACAGCGGATGAAAGAGCACCCCTCATTCGAACCTAA
ORF Protein Sequence MGRCCFYTAGTLSLLLLVTSVTLLVARVFQKAVDQSIEKKIVLRNGTEAFDSWEKPPLPVYTQFYFFNVTNPEEILRGETPRVEEVGPYTYRELRNKANIQFGDNGTTISAVSNKAYVFERDQSVGDPKIDLIRTLNIPVLTVIEWSQVHFLREIIEAMLKAYQQKLFVTHTVDELLWGYKDEILSLIHVFRPDISPYFGLFYEKNGTNDGDYVFLTGEDSYLNFTKIVEWNGKTSLDWWITDKCNMINGTDGDSFHPLITKDEVLYVFPSDFCRSVYITFSDYESVQGLPAFRYKVPAEILANTSDNAGFCIPEGNCLGSGVLNVSICKNGAPIIMSFPHFYQADERFVSAIEGMHPNQEDHETFVDINPLTGIILKAAKRFQINIYVKKLDDFVETGDIRTMVFPVMYLNESVHIDKETASRLKSMINTTLIITNIPYIIMALGVFFGLVFTWLACKGQGSMDEGTADERAPLIRT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1483-Ab Anti-SCRB2/ SCARB2/ AMRF monoclonal antibody
    Target Antigen GM-Tg-g-MP1483-Ag SCARB2 VLP (virus-like particle)
    ORF Viral Vector pGMLP003191 Human SCARB2 Lentivirus plasmid
    ORF Viral Vector pGMAD000184 Human SCARB2 Adenovirus plasmid
    ORF Viral Vector vGMLP003191 Human SCARB2 Lentivirus particle
    ORF Viral Vector vGMAD000184 Human SCARB2 Adenovirus particle


    Target information

    Target ID GM-MP1483
    Target Name SCARB2
    Gene ID 950, 12492, 699990, 117106, 101098789, 478435, 533177, 100058151
    Gene Symbol and Synonyms 9330185J12Rik,AMRF,CD36L2,EPM4,HLGP85,LGP85,LIMP II,LIMP-2,LIMPII,MLGP85,SCARB2,SR-BII
    Uniprot Accession Q14108
    Uniprot Entry Name SCRB2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000138760
    Target Classification Not Available

    The protein encoded by this gene is a type III glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes. Earlier studies in mice and rat suggested that this protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. The protein deficiency in mice was reported to impair cell membrane transport processes and cause pelvic junction obstruction, deafness, and peripheral neuropathy. Further studies in human showed that this protein is a ubiquitously expressed protein and that it is involved in the pathogenesis of HFMD (hand, foot, and mouth disease) caused by enterovirus-71 and possibly by coxsackievirus A16. Mutations in this gene caused an autosomal recessive progressive myoclonic epilepsy-4 (EPM4), also known as action myoclonus-renal failure syndrome (AMRF). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.