Human ESRRA/ERR1/ERRa ORF/cDNA clone-Adenovirus particle (NM_001282451)
Cat. No.: vGMAD000107
Pre-made Human ESRRA/ERR1/ERRa Adenovirus for ESRRA overexpression in-vitro and in-vivo. The ESRRA adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified ESRRA-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
ESRRA/ERR1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000107 | Human ESRRA Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000107 |
Gene Name | ESRRA |
Accession Number | NM_001282451 |
Gene ID | 2101 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1269 bp |
Gene Alias | ERR1,ERRa,ERRalpha,ESRL1,NR3B1 |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTCCAGCCAGGTGGTGGGCATTGAGCCTCTCTACATCAAGGCAGAGCCGGCCAGCCCTGACAGTCCAAAGGGTTCCTCGGAGACAGAGACCGAGCCTCCTGTGGCCCTGGCCCCTGGTCCAGCTCCCACTCGCTGCCTCCCAGGCCACAAGGAAGAGGAGGATGGGGAGGGGGCTGGGCCTGGCGAGCAGGGCGGTGGGAAGCTGGTGCTCAGCTCCCTGCCCAAGCGCCTCTGCCTGGTCTGTGGGGACGTGGCCTCCGGCTACCACTATGGTGTGGCATCCTGTGAGGCCTGCAAAGCCTTCTTCAAGAGGACCATCCAGGGGAGCATCGAGTACAGCTGTCCGGCCTCCAACGAGTGTGAGATCACCAAGCGGAGACGCAAGGCCTGCCAGGCCTGCCGCTTCACCAAGTGCCTGCGGGTGGGCATGCTCAAGGAGGGAGTGCGCCTGGACCGCGTCCGGGGTGGGCGGCAGAAGTACAAGCGGCGGCCGGAGGTGGACCCACTGCCCTTCCCGGGCCCCTTCCCTGCTGGGCCCCTGGCAGTCGCTGGAGGCCCCCGGAAGACAGCCCCAGTGAATGCACTGGTGTCTCATCTGCTGGTGGTTGAGCCTGAGAAGCTCTATGCCATGCCTGACCCCGCAGGCCCTGATGGGCACCTCCCAGCCGTGGCTACCCTCTGTGACCTCTTTGACCGAGAGATTGTGGTCACCATCAGCTGGGCCAAGAGCATCCCAGGCTTCTCATCGCTGTCGCTGTCTGACCAGATGTCAGTACTGCAGAGCGTGTGGATGGAGGTGCTGGTGCTGGGTGTGGCCCAGCGCTCACTGCCACTGCAGGATGAGCTGGCCTTCGCTGAGGACTTAGTCCTGGATGAAGAGGGGGCACGGGCAGCTGGCCTGGGGGAACTGGGGGCTGCCCTGCTGCAACTAGTGCGGCGGCTGCAGGCCCTGCGGCTGGAGCGAGAGGAGTATGTTCTACTAAAGGCCTTGGCCCTTGCCAATTCAGACTCTGTGCACATCGAAGATGCCGAGGCTGTGGAGCAGCTGCGAGAAGCTCTGCACGAGGCCCTGCTGGAGTATGAAGCCGGCCGGGCTGGCCCCGGAGGGGGTGCTGAGCGGCGGCGGGCGGGCAGGCTGCTGCTCACGCTACCGCTCCTCCGCCAGACAGCGGGCAAAGTGCTGGCCCATTTCTATGGGGTGAAGCTGGAGGGCAAGGTGCCCATGCACAAGCTGTTCTTGGAGATGCTCGAGGCCATGATGGACTGA |
ORF Protein Sequence | MSSQVVGIEPLYIKAEPASPDSPKGSSETETEPPVALAPGPAPTRCLPGHKEEEDGEGAGPGEQGGGKLVLSSLPKRLCLVCGDVASGYHYGVASCEACKAFFKRTIQGSIEYSCPASNECEITKRRRKACQACRFTKCLRVGMLKEGVRLDRVRGGRQKYKRRPEVDPLPFPGPFPAGPLAVAGGPRKTAPVNALVSHLLVVEPEKLYAMPDPAGPDGHLPAVATLCDLFDREIVVTISWAKSIPGFSSLSLSDQMSVLQSVWMEVLVLGVAQRSLPLQDELAFAEDLVLDEEGARAAGLGELGAALLQLVRRLQALRLEREEYVLLKALALANSDSVHIEDAEAVEQLREALHEALLEYEAGRAGPGGGAERRRAGRLLLTLPLLRQTAGKVLAHFYGVKLEGKVPMHKLFLEMLEAMMD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T72841-Ab | Anti-ESRRA monoclonal antibody |
Target Antigen | GM-Tg-g-T72841-Ag | ESRRA protein |
ORF Viral Vector | pGMLV001369 | Human ESRRA Lentivirus plasmid |
ORF Viral Vector | pGMAD000107 | Human ESRRA Adenovirus plasmid |
ORF Viral Vector | pGMAAV001454 | Human ESRRA Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | vGMLV001369 | Human ESRRA Lentivirus particle |
ORF Viral Vector | vGMAD000107 | Human ESRRA Adenovirus particle |
ORF Viral Vector | vGMAAV001454 | Human ESRRA Adeno-associate virus(AAV) particle |
Target information
Target ID | GM-T72841 |
Target Name | ESRRA |
Gene ID | 2101, 26379, 722085, 293701, 101099657, 403169, 507834, 100055615 |
Gene Symbol and Synonyms | ERR1,ERRa,ERRalpha,Errra,ESRL1,ESRRA,Estrra,NR3B1 |
Uniprot Accession | P11474 |
Uniprot Entry Name | ERR1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000173153 |
Target Classification | Nuclear Receptors |
The protein encoded by this gene is a nuclear receptor that is most closely related to the estrogen receptor. This protein acts as a site-specific transcription factor and interacts with members of the PGC-1 family of transcription cofactors to regulate the expression of most genes involved in cellular energy production as well as in the process of mitochondrial biogenesis. A processed pseudogene of ESRRA is located on chromosome 13q12.1. [provided by RefSeq, Jun 2019]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.