Human ADRB3/BETA3AR ORF/cDNA clone-Adenovirus particle (NM_000025)

Cat. No.: vGMAD000001

Pre-made Human ADRB3/BETA3AR Adenovirus for ADRB3 overexpression in-vitro and in-vivo. The ADRB3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified ADRB3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to ADRB3/BETA3AR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000001 Human ADRB3 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000001
Gene Name ADRB3
Accession Number NM_000025
Gene ID 155
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1227 bp
Gene Alias BETA3AR
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTCCGTGGCCTCACGAGAACAGCTCTCTTGCCCCATGGCCGGACCTCCCCACCCTGGCGCCCAATACCGCCAACACCAGTGGGCTGCCAGGGGTTCCGTGGGAGGCGGCCCTAGCCGGGGCCCTGCTGGCGCTGGCGGTGCTGGCCACCGTGGGAGGCAACCTGCTGGTCATCGTGGCCATCGCCTGGACTCCGAGACTCCAGACCATGACCAACGTGTTCGTGACTTCGCTGGCCGCAGCCGACCTGGTGATGGGACTCCTGGTGGTGCCGCCGGCGGCCACCTTGGCGCTGACTGGCCACTGGCCGTTGGGCGCCACTGGCTGCGAGCTGTGGACCTCGGTGGACGTGCTGTGTGTGACCGCCAGCATCGAAACCCTGTGCGCCCTGGCCGTGGACCGCTACCTGGCTGTGACCAACCCGCTGCGTTACGGCGCACTGGTCACCAAGCGCTGCGCCCGGACAGCTGTGGTCCTGGTGTGGGTCGTGTCGGCCGCGGTGTCGTTTGCGCCCATCATGAGCCAGTGGTGGCGCGTAGGGGCCGACGCCGAGGCGCAGCGCTGCCACTCCAACCCGCGCTGCTGTGCCTTCGCCTCCAACATGCCCTACGTGCTGCTGTCCTCCTCCGTCTCCTTCTACCTTCCTCTTCTCGTGATGCTCTTCGTCTACGCGCGGGTTTTCGTGGTGGCTACGCGCCAGCTGCGCTTGCTGCGCGGGGAGCTGGGCCGCTTTCCGCCCGAGGAGTCTCCGCCGGCGCCGTCGCGCTCTCTGGCCCCGGCCCCGGTGGGGACGTGCGCTCCGCCCGAAGGGGTGCCCGCCTGCGGCCGGCGGCCCGCGCGCCTCCTGCCTCTCCGGGAACACCGGGCCCTGTGCACCTTGGGTCTCATCATGGGCACCTTCACTCTCTGCTGGTTGCCCTTCTTTCTGGCCAACGTGCTGCGCGCCCTGGGGGGCCCCTCTCTAGTCCCGGGCCCGGCTTTCCTTGCCCTGAACTGGCTAGGTTATGCCAATTCTGCCTTCAACCCGCTCATCTACTGCCGCAGCCCGGACTTTCGCAGCGCCTTCCGCCGTCTTCTGTGCCGCTGCGGCCGTCGCCTGCCTCCGGAGCCCTGCGCCGCCGCCCGCCCGGCCCTCTTCCCCTCGGGCGTTCCTGCGGCCCGGAGCAGCCCAGCGCAGCCCAGGCTTTGCCAACGGCTCGACGGGGCTTCTTGGGGAGTTTCTTAG
ORF Protein Sequence MAPWPHENSSLAPWPDLPTLAPNTANTSGLPGVPWEAALAGALLALAVLATVGGNLLVIVAIAWTPRLQTMTNVFVTSLAAADLVMGLLVVPPAATLALTGHWPLGATGCELWTSVDVLCVTASIETLCALAVDRYLAVTNPLRYGALVTKRCARTAVVLVWVVSAAVSFAPIMSQWWRVGADAEAQRCHSNPRCCAFASNMPYVLLSSSVSFYLPLLVMLFVYARVFVVATRQLRLLRGELGRFPPEESPPAPSRSLAPAPVGTCAPPEGVPACGRRPARLLPLREHRALCTLGLIMGTFTLCWLPFFLANVLRALGGPSLVPGPAFLALNWLGYANSAFNPLIYCRSPDFRSAFRRLLCRCGRRLPPEPCAAARPALFPSGVPAARSSPAQPRLCQRLDGASWGVS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T51408-Ab Anti-ADRB3/ BETA3AR monoclonal antibody
    Target Antigen GM-Tg-g-T51408-Ag ADRB3 VLP (virus-like particle)
    ORF Viral Vector pGMAD000001 Human ADRB3 Adenovirus plasmid
    ORF Viral Vector vGMAD000001 Human ADRB3 Adenovirus particle


    Target information

    Target ID GM-T51408
    Target Name ADRB3
    Gene ID 155, 11556, 699129, 25645, 493930, 442979, 281606, 100147322
    Gene Symbol and Synonyms ADRB,Adrb-3,ADRB3,B3AR,BAR3,beta 3-AR,BETA3AR,GPCR
    Uniprot Accession P13945
    Uniprot Entry Name ADRB3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000188778
    Target Classification GPCR

    The protein encoded by this gene belongs to the family of beta adrenergic receptors, which mediate catecholamine-induced activation of adenylate cyclase through the action of G proteins. This receptor is located mainly in the adipose tissue and is involved in the regulation of lipolysis and thermogenesis. Obesity and bodyweight-related disorders are correlated with certain polymorphisms in three subtypes of beta-adrenoceptor, among them, the ADRB3 gene.[provided by RefSeq, Oct 2019]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.