Human F9/F9 p22/FIX ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_000133.4)

Cat. No.: vGMAAV001872

Pre-made Human F9/F9 p22/FIX Adeno-associated virus particle for F9 in-vivo study, mechanism of action (MOA) research and F9-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collection

Go to F9/F9 p22 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV001872 Human F9 Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV001872
Gene Name F9
Accession Number NM_000133.4
Gene ID 2158
Species Human
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 1386 bp
Gene Alias F9 p22,FIX,HEMB,P19,PTC,THPH8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGCGCGTGAACATGATCATGGCAGAATCACCAGGCCTCATCACCATCTGCCTTTTAGGATATCTACTCAGTGCTGAATGTACAGTTTTTCTTGATCATGAAAACGCCAACAAAATTCTGAATCGGCCAAAGAGGTATAATTCAGGTAAATTGGAAGAGTTTGTTCAAGGGAACCTTGAGAGAGAATGTATGGAAGAAAAGTGTAGTTTTGAAGAAGCACGAGAAGTTTTTGAAAACACTGAAAGAACAACTGAATTTTGGAAGCAGTATGTTGATGGAGATCAGTGTGAGTCCAATCCATGTTTAAATGGCGGCAGTTGCAAGGATGACATTAATTCCTATGAATGTTGGTGTCCCTTTGGATTTGAAGGAAAGAACTGTGAATTAGATGTAACATGTAACATTAAGAATGGCAGATGCGAGCAGTTTTGTAAAAATAGTGCTGATAACAAGGTGGTTTGCTCCTGTACTGAGGGATATCGACTTGCAGAAAACCAGAAGTCCTGTGAACCAGCAGTGCCATTTCCATGTGGAAGAGTTTCTGTTTCACAAACTTCTAAGCTCACCCGTGCTGAGACTGTTTTTCCTGATGTGGACTATGTAAATTCTACTGAAGCTGAAACCATTTTGGATAACATCACTCAAAGCACCCAATCATTTAATGACTTCACTCGGGTTGTTGGTGGAGAAGATGCCAAACCAGGTCAATTCCCTTGGCAGGTTGTTTTGAATGGTAAAGTTGATGCATTCTGTGGAGGCTCTATCGTTAATGAAAAATGGATTGTAACTGCTGCCCACTGTGTTGAAACTGGTGTTAAAATTACAGTTGTCGCAGGTGAACATAATATTGAGGAGACAGAACATACAGAGCAAAAGCGAAATGTGATTCGAATTATTCCTCACCACAACTACAATGCAGCTATTAATAAGTACAACCATGACATTGCCCTTCTGGAACTGGACGAACCCTTAGTGCTAAACAGCTACGTTACACCTATTTGCATTGCTGACAAGGAATACACGAACATCTTCCTCAAATTTGGATCTGGCTATGTAAGTGGCTGGGGAAGAGTCTTCCACAAAGGGAGATCAGCTTTAGTTCTTCAGTACCTTAGAGTTCCACTTGTTGACCGAGCCACATGTCTTCGATCTACAAAGTTCACCATCTATAACAACATGTTCTGTGCTGGCTTCCATGAAGGAGGTAGAGATTCATGTCAAGGAGATAGTGGGGGACCCCATGTTACTGAAGTGGAAGGGACCAGTTTCTTAACTGGAATTATTAGCTGGGGTGAAGAGTGTGCAATGAAAGGCAAATATGGAATATATACCAAGGTATCCCGGTATGTCAACTGGATTAAGGAAAAAACAAAGCTCACTTAA
ORF Protein Sequence MQRVNMIMAESPGLITICLLGYLLSAECTVFLDHENANKILNRPKRYNSGKLEEFVQGNLERECMEEKCSFEEAREVFENTERTTEFWKQYVDGDQCESNPCLNGGSCKDDINSYECWCPFGFEGKNCELDVTCNIKNGRCEQFCKNSADNKVVCSCTEGYRLAENQKSCEPAVPFPCGRVSVSQTSKLTRAETVFPDVDYVNSTEAETILDNITQSTQSFNDFTRVVGGEDAKPGQFPWQVVLNGKVDAFCGGSIVNEKWIVTAAHCVETGVKITVVAGEHNIEETEHTEQKRNVIRIIPHHNYNAAINKYNHDIALLELDEPLVLNSYVTPICIADKEYTNIFLKFGSGYVSGWGRVFHKGRSALVLQYLRVPLVDRATCLRSTKFTIYNNMFCAGFHEGGRDSCQGDSGGPHVTEVEGTSFLTGIISWGEECAMKGKYGIYTKVSRYVNWIKEKTKLT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-726 Pre-Made Albutrepenonacog Alfa Biosimilar, Fusion Protein targeting F9 fused with ALB (albumin, human serum albumin, HSA): Recombinant therapeutic protein targeting FIX/P19/PTC/HEMB/THPH8
    Biosimilar GMP-Bios-INN-929 Pre-Made Nonacog Gamma Biosimilar, Recombinant Protein targeting F9: Recombinant therapeutic protein targeting FIX/P19/PTC/HEMB/THPH8
    Biosimilar GMP-Bios-INN-792 Pre-Made Dalcinonacog Alfa Biosimilar, Recombinant Protein targeting F9: Recombinant therapeutic protein targeting FIX/P19/PTC/HEMB/THPH8
    Biosimilar GMP-Bios-ab-177 Pre-Made Emicizumab biosimilar, Bispecific mAb, Anti-F9;F10 Antibody: Anti-FIX/HEMB/P19/PTC/THPH8;FX/FXA therapeutic antibody
    Biosimilar GMP-Bios-INN-830 Pre-Made Eftrenonacog Alfa Biosimilar, Fusion Protein targeting F9 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting FIX/P19/PTC/HEMB/THPH8
    Target Antibody GM-Tg-g-T83369-Ab Anti-FA9/ F9/ F9 p22 monoclonal antibody
    Target Antigen GM-Tg-g-T83369-Ag F9 VLP (virus-like particle)
    ORF Viral Vector pGMAD000413 Human F9 Adenovirus plasmid
    ORF Viral Vector pGMAAV001872 Human F9 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000457 Human F9 Adenovirus plasmid
    ORF Viral Vector pGMPC001845 Human F9 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMAD000413 Human F9 Adenovirus particle
    ORF Viral Vector vGMAAV001872 Human F9 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000457 Human F9 Adenovirus particle


    Target information

    Target ID GM-T83369
    Target Name F9
    Gene ID 2158, 14071, 695578, 24946, 493973, 404015, 100054449
    Gene Symbol and Synonyms Cf-9,Cf9,F9,F9 p22,FIX,HEMB,P19,PTC,THPH8
    Uniprot Accession P00740
    Uniprot Entry Name FA9_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000101981
    Target Classification Not Available

    This gene encodes vitamin K-dependent coagulation factor IX that circulates in the blood as an inactive zymogen. This factor is converted to an active form by factor XIa, which excises the activation peptide and thus generates a heavy chain and a light chain held together by one or more disulfide bonds. The role of this activated factor IX in the blood coagulation cascade is to activate factor X to its active form through interactions with Ca+2 ions, membrane phospholipids, and factor VIII. Alterations of this gene, including point mutations, insertions and deletions, cause factor IX deficiency, which is a recessive X-linked disorder, also called hemophilia B or Christmas disease. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.