Human DAO/DAAO/DAMOX ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001917.5)

Cat. No.: pGMPC001563
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DAO/DAAO/DAMOX Non-Viral expression plasmid (overexpression vector) for mouse DAO overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to DAO/DAAO products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001563
Gene Name DAO
Accession Number NM_001917.5
Gene ID 1610
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1044 bp
Gene Alias DAAO,DAMOX,OXDA
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGTGTGGTGGTGATTGGAGCAGGAGTCATCGGGCTGTCCACCGCCCTCTGCATCCATGAGCGCTACCACTCAGTCCTGCAGCCACTGGACATAAAGGTCTACGCGGACCGCTTCACCCCACTCACCACCACCGACGTGGCTGCCGGCCTCTGGCAGCCCTACCTTTCTGACCCCAACAACCCACAGGAGGCGGACTGGAGCCAACAGACCTTTGACTATCTCCTGAGCCATGTCCATTCTCCCAACGCTGAAAACCTGGGCCTGTTCCTAATCTCGGGCTACAACCTCTTCCATGAAGCCATTCCGGACCCTTCCTGGAAGGACACAGTTCTGGGATTTCGGAAGCTGACCCCCAGAGAGCTGGATATGTTCCCAGATTACGGCTATGGCTGGTTCCACACAAGCCTAATTCTGGAGGGAAAGAACTATCTACAGTGGCTGACTGAAAGGTTAACTGAGAGGGGAGTGAAGTTCTTCCAGCGGAAAGTGGAGTCTTTTGAGGAGGTGGCAAGAGAAGGCGCAGACGTGATTGTCAACTGCACTGGGGTATGGGCTGGGGCGCTACAACGAGACCCCCTGCTGCAGCCAGGCCGGGGGCAGATCATGAAGGTGGACGCCCCTTGGATGAAGCACTTCATTCTCACCCATGACCCAGAGAGAGGCATCTACAATTCCCCGTACATCATCCCAGGGACCCAGACAGTTACTCTTGGAGGCATCTTCCAGTTGGGAAACTGGAGTGAACTAAACAATATCCAGGACCACAACACCATTTGGGAAGGCTGCTGCAGACTGGAGCCCACACTGAAGAATGCAAGAATTATTGGTGAACGAACTGGCTTCCGGCCAGTACGCCCCCAGATTCGGCTAGAAAGAGAACAGCTTCGCACTGGACCTTCAAACACAGAGGTCATCCACAACTATGGCCATGGAGGCTACGGGCTCACCATCCACTGGGGATGTGCCCTGGAGGCAGCCAAGCTCTTTGGGAGAATCCTGGAAGAAAAGAAATTGTCCAGAATGCCACCATCCCACCTCTGA
ORF Protein Sequence MRVVVIGAGVIGLSTALCIHERYHSVLQPLDIKVYADRFTPLTTTDVAAGLWQPYLSDPNNPQEADWSQQTFDYLLSHVHSPNAENLGLFLISGYNLFHEAIPDPSWKDTVLGFRKLTPRELDMFPDYGYGWFHTSLILEGKNYLQWLTERLTERGVKFFQRKVESFEEVAREGADVIVNCTGVWAGALQRDPLLQPGRGQIMKVDAPWMKHFILTHDPERGIYNSPYIIPGTQTVTLGGIFQLGNWSELNNIQDHNTIWEGCCRLEPTLKNARIIGERTGFRPVRPQIRLEREQLRTGPSNTEVIHNYGHGGYGLTIHWGCALEAAKLFGRILEEKKLSRMPPSHL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T33124-Ab Anti-OXDA/ DAO/ DAAO functional antibody
    Target Antigen GM-Tg-g-T33124-Ag DAO protein
    ORF Viral Vector pGMLP000307 Human DAO Lentivirus plasmid
    ORF Viral Vector pGMPC001563 Human DAO Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000307 Human DAO Lentivirus particle


    Target information

    Target ID GM-T33124
    Target Name DAO
    Gene ID 1610, 13142, 706373, 114027, 101087429, 486317, 615334, 100059819
    Gene Symbol and Synonyms DAAO,DAMOX,DAO,Dao-1,Dao1,OXDA
    Uniprot Accession P14920
    Uniprot Entry Name OXDA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000110887
    Target Classification Not Available

    This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.