Human CD274/B7-H/B7H1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_014143.3)

Cat. No.: pGMPC000459
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD274/B7-H/B7H1 Non-Viral expression plasmid (overexpression vector) for mouse CD274 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to PD-L1/CD274/B7-H products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000459
Gene Name CD274
Accession Number NM_014143.3
Gene ID 29126
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 873 bp
Gene Alias B7-H,B7H1,PD-L1,PDCD1L1,PDCD1LG1,PDL1
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCATTTACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTGCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTCCTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTAGATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCTCCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCACTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATCCAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA
ORF Protein Sequence MRIFAVFIFMTYWHLLNAFTVTVPKDLYVVEYGSNMTIECKFPVEKQLDLAALIVYWEMEDKNIIQFVHGEEDLKVQHSSYRQRARLLKDQLSLGNAALQITDVKLQDAGVYRCMISYGGADYKRITVKVNAPYNKINQRILVVDPVTSEHELTCQAEGYPKAEVIWTSSDHQVLSGKTTTTNSKREEKLFNVTSTLRINTTTNEIFYCTFRRLDPEENHTAELVIPELPLAHPPNERTHLVILGAILLCLGVALTFIFRLRKGRMMDVKKCGIQDTNSKKQSDTHLEET

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-422 Pre-Made Pacmilimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-040 Pre-Made Avelumab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-INN-972 Pre-Made Retlirafusp Alfa Biosimilar, Fusion Protein targeting CD274/PD-L1 fused with human TGFBR2 (transforming growth factor beta receptor 2) extracellular fragment (20-136) via a peptidyl linker: Recombinant therapeutic protein targeting B7-H/B7H1/PDCD1L1/PDCD1LG1
    Biosimilar GMP-Bios-ab-034 Pre-Made Atezolizumab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-159 Pre-Made Durvalumab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-534 Pre-Made Sugemalimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-409 Pre-Made Opucolimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-188 Pre-Made Envafolimab biosimilar, Single Domain Variable Fragment;H, Anti-CD274/PD-L1 Antibody: Anti-B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1 therapeutic antibody
    Biosimilar GMP-Bios-ab-533 Pre-Made Sudubrilimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-071 Pre-Made Bintrafusp biosimilar, Whole mAb Fusion, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-481 Pre-Made Retlirafusp biosimilar, Whole mAb Fusion, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-698 Pre-Made Tagitanlimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-INN-797 Pre-Made Davoceticept Biosimilar, Fusion Protein targeting CD274/PD-L1 fused with human IGHG1 Fc (Fragment constant) via a peptidyl linker: Recombinant therapeutic protein targeting B7-H/B7H1/PDCD1L1/PDCD1LG1
    Biosimilar GMP-Bios-ab-121 Pre-Made Cosibelimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-INN-762 Pre-Made Bintrafusp Alfa Biosimilar, Fusion Protein targeting CD274/PD-L1 fused with human TGFBR2 (transforming growth factor beta receptor 2) (1:2) via a peptidyl linker: Recombinant therapeutic protein targeting B7-H/B7H1/PDCD1L1/PDCD1LG1
    Biosimilar GMP-Bios-ab-317 Pre-Made Lodapolimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-194 Pre-Made Erfonrilimab biosimilar, Bispecific Single Domains (VH-VH'-CH), Anti-CD274/PD-L1;CTLA4/CTLA-4 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1;CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-010 Pre-Made Adebrelimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-693 Pre-Made Simridarlimab biosimilar, Whole mAb, Anti-CD47;CD274/PD-L1 Antibody: Anti-IAP/OA3/MER6;B7-H/B7H1/PD-L1/PDCD1L1/PDCD1LG1/PDL1/hPD-L1 therapeutic antibody
    Biosimilar GMP-Bios-ab-235 Pre-Made Garivulimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-695 Pre-Made Socazolimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-007 Pre-Made Acasunlimab biosimilar, Bispecific mAb, Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1/PDL1/hPD-L1;ILA/4-1BB/CDw137 Antibod: Anti-CD274/PD-L1;TNFRSF9/CD137 therapeutic antibody
    Biosimilar GMP-Bios-ab-334 Pre-Made Manelimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Target Antibody GM-Tg-g-T99948-Ab Anti-PD1L1/ PD-L1/ CD274 monoclonal antibody
    Target Antigen GM-Tg-g-T99948-Ag PD-L1/CD274 VLP (virus-like particle)
    ORF Viral Vector pGMLV000121 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV000710 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV000749 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV001704 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV001797 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV001918 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV002461 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV002726 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMAD001278 Human CD274 Adenovirus plasmid
    ORF Viral Vector pGMPC000014 Human CD274 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000459 Human CD274 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000807 Human CD274 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001107 Human CD274 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000121 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV000710 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV000749 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV001704 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV001797 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV001918 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV002461 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV002726 Human CD274 Lentivirus particle
    ORF Viral Vector vGMAD001278 Human CD274 Adenovirus particle


    Target information

    Target ID GM-T99948
    Target Name PD-L1
    Gene ID 29126, 60533, 716043, 499342, 100127110, 484186, 533834, 100051703
    Gene Symbol and Synonyms A530045L16Rik,B7-H,B7H1,CD274,hPD-L1,PD-L1,PDCD1L1,PDCD1LG1,PDL1,RGD1566211
    Uniprot Accession Q9NZQ7
    Uniprot Entry Name PD1L1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000120217
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Expression of this gene in tumor cells is considered to be prognostic in many types of human malignancies, including colon cancer and renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.