Human SFRP2/FRP-2/ SARP1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_003013.3)

Pre-made Human SFRP2/FRP-2/ SARP1 Non-Viral expression plasmid (overexpression vector) for mouse SFRP2 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to SFRP2/FRP-2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000352 Human SFRP2 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000352
Gene Name SFRP2
Accession Number NM_003013.3
Gene ID 6423
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 888 bp
Gene Alias FRP-2, SARP1, SDF-5
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCAGGGCCCTGGCTCGCTGCTGCTGCTCTTCCTCGCCTCGCACTGCTGCCTGGGCTCGGCGCGCGGGCTCTTCCTCTTTGGCCAGCCCGACTTCTCCTACAAGCGCAGCAATTGCAAGCCCATCCCTGCCAACCTGCAGCTGTGCCACGGCATCGAATACCAGAACATGCGGCTGCCCAACCTGCTGGGCCACGAGACCATGAAGGAGGTGCTGGAGCAGGCCGGCGCTTGGATCCCGCTGGTCATGAAGCAGTGCCACCCGGACACCAAGAAGTTCCTGTGCTCGCTCTTCGCCCCCGTCTGCCTCGATGACCTAGACGAGACCATCCAGCCATGCCACTCGCTCTGCGTGCAGGTGAAGGACCGCTGCGCCCCGGTCATGTCCGCCTTCGGCTTCCCCTGGCCCGACATGCTTGAGTGCGACCGTTTCCCCCAGGACAACGACCTTTGCATCCCCCTCGCTAGCAGCGACCACCTCCTGCCAGCCACCGAGGAAGCTCCAAAGGTATGTGAAGCCTGCAAAAATAAAAATGATGATGACAACGACATAATGGAAACGCTTTGTAAAAATGATTTTGCACTGAAAATAAAAGTGAAGGAGATAACCTACATCAACCGAGATACCAAAATCATCCTGGAGACCAAGAGCAAGACCATTTACAAGCTGAACGGTGTGTCCGAAAGGGACCTGAAGAAATCGGTGCTGTGGCTCAAAGACAGCTTGCAGTGCACCTGTGAGGAGATGAACGACATCAACGCGCCCTATCTGGTCATGGGACAGAAACAGGGTGGGGAGCTGGTGATCACCTCGGTGAAGCGGTGGCAGAAGGGGCAGAGAGAGTTCAAGCGCATCTCCCGCAGCATCCGCAAGCTGCAGTGCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1284-Ab Anti-SFRP2/ FRP-2/ SARP1 functional antibody
    Target Antigen GM-Tg-g-SE1284-Ag SFRP2 protein
    ORF Viral Vector pGMPC000352 Human SFRP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP003519 Human SFRP2 Lentivirus plasmid
    ORF Viral Vector pGMLP004043 Human SFRP2 Lentivirus plasmid
    ORF Viral Vector vGMLP003519 Human SFRP2 Lentivirus particle
    ORF Viral Vector vGMLP004043 Human SFRP2 Lentivirus particle


    Target information

    Target ID GM-SE1284
    Target Name SFRP2
    Gene ID 6423, 20319, 699915, 310552, 101093851, 475471, 510821, 100069959
    Gene Symbol and Synonyms FRP-2,SARP1,SDF-5,Sdf5,SFRP-2,SFRP2
    Uniprot Accession Q96HF1
    Uniprot Entry Name SFRP2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000145423
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. Methylation of this gene is a potential marker for the presence of colorectal cancer. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.