Human SCD/FADS5/hSCD1 ORF/cDNA clone-Lentivirus plasmid (NM_005063)
Cat. No.: pGMLV002596
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SCD/FADS5/hSCD1 Lentiviral expression plasmid for SCD lentivirus packaging, SCD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SCD/FADS5 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV002596 |
Gene Name | SCD |
Accession Number | NM_005063 |
Gene ID | 6319 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1080 bp |
Gene Alias | FADS5,hSCD1,MSTP008,SCD1,SCDOS |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCCGGCCCACTTGCTGCAGGACGATATCTCTAGCTCCTATACCACCACCACCACCATTACAGCGCCTCCCTCCAGGGTCCTGCAGAATGGAGGAGATAAGTTGGAGACGATGCCCCTCTACTTGGAAGACGACATTCGCCCTGATATAAAAGATGATATATATGACCCCACCTACAAGGATAAGGAAGGCCCAAGCCCCAAGGTTGAATATGTCTGGAGAAACATCATCCTTATGTCTCTGCTACACTTGGGAGCCCTGTATGGGATCACTTTGATTCCTACCTGCAAGTTCTACACCTGGCTTTGGGGGGTATTCTACTATTTTGTCAGTGCCCTGGGCATAACAGCAGGAGCTCATCGTCTGTGGAGCCACCGCTCTTACAAAGCTCGGCTGCCCCTACGGCTCTTTCTGATCATTGCCAACACAATGGCATTCCAGAATGATGTCTATGAATGGGCTCGTGACCACCGTGCCCACCACAAGTTTTCAGAAACACATGCTGATCCTCATAATTCCCGACGTGGCTTTTTCTTCTCTCACGTGGGTTGGCTGCTTGTGCGCAAACACCCAGCTGTCAAAGAGAAGGGGAGTACGCTAGACTTGTCTGACCTAGAAGCTGAGAAACTGGTGATGTTCCAGAGGAGGTACTACAAACCTGGCTTGCTGATGATGTGCTTCATCCTGCCCACGCTTGTGCCCTGGTATTTCTGGGGTGAAACTTTTCAAAACAGTGTGTTCGTTGCCACTTTCTTGCGATATGCTGTGGTGCTTAATGCCACCTGGCTGGTGAACAGTGCTGCCCACCTCTTCGGATATCGTCCTTATGACAAGAACATTAGCCCCCGGGAGAATATCCTGGTTTCACTTGGAGCTGTGGGTGAGGGCTTCCACAACTACCACCACTCCTTTCCCTATGACTACTCTGCCAGTGAGTACCGCTGGCACATCAACTTCACCACATTCTTCATTGATTGCATGGCCGCCCTCGGTCTGGCCTATGACCGGAAGAAAGTCTCCAAGGCCGCCATCTTGGCCAGGATTAAAAGAACCGGAGATGGAAACTACAAGAGTGGCTGA |
ORF Protein Sequence | MPAHLLQDDISSSYTTTTTITAPPSRVLQNGGDKLETMPLYLEDDIRPDIKDDIYDPTYKDKEGPSPKVEYVWRNIILMSLLHLGALYGITLIPTCKFYTWLWGVFYYFVSALGITAGAHRLWSHRSYKARLPLRLFLIIANTMAFQNDVYEWARDHRAHHKFSETHADPHNSRRGFFFSHVGWLLVRKHPAVKEKGSTLDLSDLEAEKLVMFQRRYYKPGLLMMCFILPTLVPWYFWGETFQNSVFVATFLRYAVVLNATWLVNSAAHLFGYRPYDKNISPRENILVSLGAVGEGFHNYHHSFPYDYSASEYRWHINFTTFFIDCMAALGLAYDRKKVSKAAILARIKRTGDGNYKSG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0008-Ab | Anti-SCD monoclonal antibody |
Target Antigen | GM-Tg-g-IP0008-Ag | SCD protein |
ORF Viral Vector | pGMLP003589 | Human SCD Lentivirus plasmid |
ORF Viral Vector | pGMLV002596 | Human SCD Lentivirus plasmid |
ORF Viral Vector | pGMPC001222 | Human SCD Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP003589 | Human SCD Lentivirus particle |
ORF Viral Vector | vGMLV002596 | Human SCD Lentivirus particle |
Target information
Target ID | GM-IP0008 |
Target Name | SCD |
Gene ID | 6319, 710155, 101091403, 486839, 280924, 100060485 |
Gene Symbol and Synonyms | FADS5,hSCD1,MSTP008,SCD,SCD1,SCDOS |
Uniprot Accession | O00767 |
Uniprot Entry Name | SCD_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000099194 |
Target Classification | Not Available |
This gene encodes an enzyme involved in fatty acid biosynthesis, primarily the synthesis of oleic acid. The protein belongs to the fatty acid desaturase family and is an integral membrane protein located in the endoplasmic reticulum. Transcripts of approximately 3.9 and 5.2 kb, differing only by alternative polyadenlyation signals, have been detected. A gene encoding a similar enzyme is located on chromosome 4 and a pseudogene of this gene is located on chromosome 17. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.