Human SCD/FADS5/hSCD1 ORF/cDNA clone-Lentivirus plasmid (NM_005063)

Cat. No.: pGMLV002596
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SCD/FADS5/hSCD1 Lentiviral expression plasmid for SCD lentivirus packaging, SCD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SCD/FADS5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $602.4
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002596
Gene Name SCD
Accession Number NM_005063
Gene ID 6319
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1080 bp
Gene Alias FADS5,hSCD1,MSTP008,SCD1,SCDOS
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCGGCCCACTTGCTGCAGGACGATATCTCTAGCTCCTATACCACCACCACCACCATTACAGCGCCTCCCTCCAGGGTCCTGCAGAATGGAGGAGATAAGTTGGAGACGATGCCCCTCTACTTGGAAGACGACATTCGCCCTGATATAAAAGATGATATATATGACCCCACCTACAAGGATAAGGAAGGCCCAAGCCCCAAGGTTGAATATGTCTGGAGAAACATCATCCTTATGTCTCTGCTACACTTGGGAGCCCTGTATGGGATCACTTTGATTCCTACCTGCAAGTTCTACACCTGGCTTTGGGGGGTATTCTACTATTTTGTCAGTGCCCTGGGCATAACAGCAGGAGCTCATCGTCTGTGGAGCCACCGCTCTTACAAAGCTCGGCTGCCCCTACGGCTCTTTCTGATCATTGCCAACACAATGGCATTCCAGAATGATGTCTATGAATGGGCTCGTGACCACCGTGCCCACCACAAGTTTTCAGAAACACATGCTGATCCTCATAATTCCCGACGTGGCTTTTTCTTCTCTCACGTGGGTTGGCTGCTTGTGCGCAAACACCCAGCTGTCAAAGAGAAGGGGAGTACGCTAGACTTGTCTGACCTAGAAGCTGAGAAACTGGTGATGTTCCAGAGGAGGTACTACAAACCTGGCTTGCTGATGATGTGCTTCATCCTGCCCACGCTTGTGCCCTGGTATTTCTGGGGTGAAACTTTTCAAAACAGTGTGTTCGTTGCCACTTTCTTGCGATATGCTGTGGTGCTTAATGCCACCTGGCTGGTGAACAGTGCTGCCCACCTCTTCGGATATCGTCCTTATGACAAGAACATTAGCCCCCGGGAGAATATCCTGGTTTCACTTGGAGCTGTGGGTGAGGGCTTCCACAACTACCACCACTCCTTTCCCTATGACTACTCTGCCAGTGAGTACCGCTGGCACATCAACTTCACCACATTCTTCATTGATTGCATGGCCGCCCTCGGTCTGGCCTATGACCGGAAGAAAGTCTCCAAGGCCGCCATCTTGGCCAGGATTAAAAGAACCGGAGATGGAAACTACAAGAGTGGCTGA
ORF Protein Sequence MPAHLLQDDISSSYTTTTTITAPPSRVLQNGGDKLETMPLYLEDDIRPDIKDDIYDPTYKDKEGPSPKVEYVWRNIILMSLLHLGALYGITLIPTCKFYTWLWGVFYYFVSALGITAGAHRLWSHRSYKARLPLRLFLIIANTMAFQNDVYEWARDHRAHHKFSETHADPHNSRRGFFFSHVGWLLVRKHPAVKEKGSTLDLSDLEAEKLVMFQRRYYKPGLLMMCFILPTLVPWYFWGETFQNSVFVATFLRYAVVLNATWLVNSAAHLFGYRPYDKNISPRENILVSLGAVGEGFHNYHHSFPYDYSASEYRWHINFTTFFIDCMAALGLAYDRKKVSKAAILARIKRTGDGNYKSG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0008-Ab Anti-SCD monoclonal antibody
    Target Antigen GM-Tg-g-IP0008-Ag SCD protein
    ORF Viral Vector pGMLP003589 Human SCD Lentivirus plasmid
    ORF Viral Vector pGMLV002596 Human SCD Lentivirus plasmid
    ORF Viral Vector pGMPC001222 Human SCD Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003589 Human SCD Lentivirus particle
    ORF Viral Vector vGMLV002596 Human SCD Lentivirus particle


    Target information

    Target ID GM-IP0008
    Target Name SCD
    Gene ID 6319, 710155, 101091403, 486839, 280924, 100060485
    Gene Symbol and Synonyms FADS5,hSCD1,MSTP008,SCD,SCD1,SCDOS
    Uniprot Accession O00767
    Uniprot Entry Name SCD_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000099194
    Target Classification Not Available

    This gene encodes an enzyme involved in fatty acid biosynthesis, primarily the synthesis of oleic acid. The protein belongs to the fatty acid desaturase family and is an integral membrane protein located in the endoplasmic reticulum. Transcripts of approximately 3.9 and 5.2 kb, differing only by alternative polyadenlyation signals, have been detected. A gene encoding a similar enzyme is located on chromosome 4 and a pseudogene of this gene is located on chromosome 17. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.