Human CRP/PTX1 ORF/cDNA clone-Lentivirus plasmid (NM_000567.3)
Cat. No.: pGMLV002473
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CRP/PTX1 Lentiviral expression plasmid for CRP lentivirus packaging, CRP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CRP/PTX1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV002473 |
Gene Name | CRP |
Accession Number | NM_000567.3 |
Gene ID | 1401 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 675 bp |
Gene Alias | PTX1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGAGAAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAGGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACACGGAACTGTCCTCGACCCGTGGGTACAGTATTTTCTCGTATGCCACCAAGAGACAAGACAATGAGATTCTCATATTTTGGTCTAAGGATATAGGATACAGTTTTACAGTGGGTGGGTCTGAAATATTATTCGAGGTTCCTGAAGTCACAGTAGCTCCAGTACACATTTGTACAAGCTGGGAGTCCGCCTCAGGGATCGTGGAGTTCTGGGTAGATGGGAAGCCCAGGGTGAGGAAGAGTCTGAAGAAGGGATACACTGTGGGGGCAGAAGCAAGCATCATCTTGGGGCAGGAGCAGGATTCCTTCGGTGGGAACTTTGAAGGAAGCCAGTCCCTGGTGGGAGACATTGGAAATGTGAACATGTGGGACTTTGTGCTGTCACCAGATGAGATTAACACCATCTATCTTGGCGGGCCCTTCAGTCCTAATGTCCTGAACTGGCGGGCACTGAAGTATGAAGTGCAAGGCGAAGTGTTCACCAAACCCCAGCTGTGGCCCTGA |
ORF Protein Sequence | MEKLLCFLVLTSLSHAFGQTDMSRKAFVFPKESDTSYVSLKAPLTKPLKAFTVCLHFYTELSSTRGYSIFSYATKRQDNEILIFWSKDIGYSFTVGGSEILFEVPEVTVAPVHICTSWESASGIVEFWVDGKPRVRKSLKKGYTVGAEASIILGQEQDSFGGNFEGSQSLVGDIGNVNMWDFVLSPDEINTIYLGGPFSPNVLNWRALKYEVQGEVFTKPQLWP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0824-Ab | Anti-CRP/ PTX1 functional antibody |
Target Antigen | GM-Tg-g-SE0824-Ag | CRP protein |
Cytokine | cks-Tg-g-GM-SE0824 | C-reactive protein, pentraxin-related (CRP) protein & antibody |
ORF Viral Vector | pGMLV002473 | Human CRP Lentivirus plasmid |
ORF Viral Vector | pGMAAV000165 | Human CRP Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000461 | Human CRP Adenovirus plasmid |
ORF Viral Vector | vGMLV002473 | Human CRP Lentivirus particle |
ORF Viral Vector | vGMAAV000165 | Human CRP Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000461 | Human CRP Adenovirus particle |
Target information
Target ID | GM-SE0824 |
Target Name | CRP |
Gene ID | 1401, 12944, 719454, 25419, 101093079, 488629, 527553, 100057752 |
Gene Symbol and Synonyms | Aa1249,Ab1-341,Ab2-196,Ac1-114,Ac1262,Ac2-069,Ba2-693,CRP,PTX1 |
Uniprot Accession | P02741 |
Uniprot Entry Name | CRP_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Diagnostics Biomarker, Cytokine Target |
Disease | Breast Cancer, cardiovascular disease, Pregnant state, pancreatic, renal, gastrointestinal, tissue damage, Acute coronary syndromes, Cardiovascular Diseases, cardiovascular events, Cardiovascular Events, cardiovascular outcome, coronary ischemic events, infections, Infectious disease: falciparum malaria, Infectious disease: AIDS, Infectious disease: ATL, Infectious disease: hepatitis, Infectious disease: herpes simplex, Infectious disease: syphilis, Infectious disease: TB, Inflammation, Inflammatory reactions, lymphoma, Mediastinal lympadenopathy, melanoma, myeloma, ovarian, Sepsis, neonatal infections, Non-small cell lung carcinoma |
Gene Ensembl | ENSG00000132693 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the pentraxin family which also includes serum amyloid P component protein and pentraxin 3. Pentraxins are involved in complement activation and amplification via communication with complement initiation pattern recognition molecules, but also complement regulation via recruitment of complement regulators. The encoded protein has a calcium dependent ligand binding domain with a distinctive flattened beta-jellyroll structure. It exists in two forms as either a pentamer in circulation or as a nonsoluble monomer in tissues. It is involved in several host defense related functions based on its ability to recognize foreign pathogens and damaged cells of the host and to initiate their elimination by interacting with humoral and cellular effector systems in the blood. Consequently, the level of this protein in plasma increases greatly during acute phase response to tissue injury, infection, or other inflammatory stimuli. Elevated expression of the encoded protein is associated with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.